Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Rasgrp4'

235348

Institutional Source

Beutler Lab

Gene Symbol

Rasgrp4

Ensembl Gene

ENSMUSG00000030589

Gene Name

RAS guanyl releasing protein 4

Synonyms

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29134851-29153961 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29139045 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 106 (Y106C)

Ref Sequence

ENSEMBL: ENSMUSP00000144774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000161522] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000205027] [ENSMUST00000204845]

AlphaFold

Q8BTM9

Predicted Effect

probably damaging
Transcript: ENSMUST00000032811
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Blast:RasGEFN	66	162	1e-30	BLAST
low complexity region	163	188	N/A	INTRINSIC
RasGEF	197	433	2.92e-70	SMART
C1	541	590	4.12e-12	SMART
low complexity region	600	609	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094617
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589
AA Change: Y107C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Blast:RasGEFN	66	163	2e-29	BLAST
low complexity region	164	189	N/A	INTRINSIC
RasGEF	198	434	2.92e-70	SMART
C1	542	596	1.81e-8	SMART
low complexity region	606	615	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159351
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Blast:RasGEFN	66	162	7e-31	BLAST
low complexity region	163	188	N/A	INTRINSIC
RasGEF	197	433	2.92e-70	SMART
Blast:RasGEF	449	553	7e-25	BLAST
SCOP:d1ptq__	541	573	1e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159898

Predicted Effect

probably damaging
Transcript: ENSMUST00000159975
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Blast:RasGEFN	66	162	1e-30	BLAST
low complexity region	163	188	N/A	INTRINSIC
RasGEF	197	433	2.92e-70	SMART
C1	541	595	1.81e-8	SMART
low complexity region	605	614	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160194
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Blast:RasGEFN	66	162	8e-32	BLAST
low complexity region	163	188	N/A	INTRINSIC
RasGEF	197	423	6.73e-61	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161522
AA Change: Y106C

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Blast:RasGEFN	66	165	7e-32	BLAST
RasGEF	183	419	2.92e-70	SMART
C1	527	576	4.12e-12	SMART
low complexity region	586	595	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162641

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162946

Predicted Effect

probably damaging
Transcript: ENSMUST00000203070
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
RasGEFN	48	172	2.6e-3	SMART
RasGEF	197	504	1.8e-20	SMART
C1	449	498	2.1e-14	SMART
low complexity region	508	517	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000203380
AA Change: Y106C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
RasGEFN	48	172	2.6e-3	SMART
RasGEF	197	364	3e-25	SMART
C1	472	521	2.1e-14	SMART
low complexity region	531	540	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204194
AA Change: Y106C

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
RasGEFN	48	172	2.6e-3	SMART
RasGEF	85	336	1e-7	SMART
C1	444	493	2.1e-14	SMART
low complexity region	503	512	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205027
AA Change: Y106C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
RasGEFN	48	172	2.6e-3	SMART
C1	352	401	2.1e-14	SMART
low complexity region	411	420	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000204845
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589
AA Change: Y106C

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
RasGEFN	48	172	2.6e-3	SMART
RasGEF	197	399	8.7e-49	SMART
C1	507	556	2.1e-14	SMART
low complexity region	566	575	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil reactive oxygen species production and chemotaxis in vitro. Mice homozygous for another knock-out allele exhibit decreased susceptibility to induced colitis and arthritis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Rasgrp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Rasgrp4	APN	7	29148541	splice site	probably benign
IGL01145:Rasgrp4	APN	7	29151473	missense	possibly damaging	0.83
IGL01806:Rasgrp4	APN	7	29139050	missense	possibly damaging	0.83
IGL02023:Rasgrp4	APN	7	29138910	missense	probably damaging	1.00
IGL02499:Rasgrp4	APN	7	29151503	utr 3 prime	probably benign
IGL02989:Rasgrp4	APN	7	29148406	missense	probably damaging	1.00
IGL03281:Rasgrp4	APN	7	29146025	missense	possibly damaging	0.69
R0092:Rasgrp4	UTSW	7	29145132	missense	possibly damaging	0.74
R0390:Rasgrp4	UTSW	7	29145860	missense	probably damaging	1.00
R0614:Rasgrp4	UTSW	7	29145851	missense	probably damaging	1.00
R0628:Rasgrp4	UTSW	7	29140210	intron	probably benign
R1420:Rasgrp4	UTSW	7	29140345	missense	probably damaging	0.98
R1434:Rasgrp4	UTSW	7	29137727	critical splice donor site	probably null
R1664:Rasgrp4	UTSW	7	29140263	missense	probably benign	0.00
R1911:Rasgrp4	UTSW	7	29138877	missense	probably damaging	1.00
R4277:Rasgrp4	UTSW	7	29152594	unclassified	probably benign
R5024:Rasgrp4	UTSW	7	29148407	missense	probably damaging	1.00
R5423:Rasgrp4	UTSW	7	29145136	missense	probably damaging	1.00
R5813:Rasgrp4	UTSW	7	29145214	missense	probably damaging	1.00
R5823:Rasgrp4	UTSW	7	29137717	missense	probably benign	0.00
R6268:Rasgrp4	UTSW	7	29143068	missense	probably damaging	1.00
R6285:Rasgrp4	UTSW	7	29148383	missense	probably damaging	1.00
R7062:Rasgrp4	UTSW	7	29150194	missense	possibly damaging	0.92
R7269:Rasgrp4	UTSW	7	29148430	missense	probably damaging	1.00
R7471:Rasgrp4	UTSW	7	29145980	missense	probably damaging	1.00
R7535:Rasgrp4	UTSW	7	29139059	missense	probably benign
R7792:Rasgrp4	UTSW	7	29143102	missense	probably damaging	1.00
R7854:Rasgrp4	UTSW	7	29150610	missense	unknown
R7855:Rasgrp4	UTSW	7	29150610	missense	unknown
R8052:Rasgrp4	UTSW	7	29149937	missense	probably damaging	1.00
R8144:Rasgrp4	UTSW	7	29149117	missense	probably damaging	1.00
R8253:Rasgrp4	UTSW	7	29138862	missense	possibly damaging	0.63
R8256:Rasgrp4	UTSW	7	29143075	missense	probably damaging	1.00
R8671:Rasgrp4	UTSW	7	29143027	missense	probably damaging	0.99
R8675:Rasgrp4	UTSW	7	29143027	missense	probably damaging	0.99
R8872:Rasgrp4	UTSW	7	29139096	missense	possibly damaging	0.86
R9647:Rasgrp4	UTSW	7	29140492	missense	probably damaging	0.99
R9681:Rasgrp4	UTSW	7	29150262	missense	probably benign
Z1088:Rasgrp4	UTSW	7	29150536	intron	probably benign
Z1186:Rasgrp4	UTSW	7	29137587	missense	probably benign
Z1186:Rasgrp4	UTSW	7	29138816	missense	probably benign	0.01
Z1186:Rasgrp4	UTSW	7	29145877	missense	probably benign	0.01
Z1186:Rasgrp4	UTSW	7	29148560	missense	probably benign	0.01
Z1186:Rasgrp4	UTSW	7	29148635	missense	probably damaging	1.00
Z1186:Rasgrp4	UTSW	7	29150592	intron	probably benign
Z1186:Rasgrp4	UTSW	7	29150596	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- AGATGGTGCTCACGATGCAC -3'
(R):5'- CCAATGGCATCTTAGCATGGG -3'

Sequencing Primer
(F):5'- TGCTCACGATGCACAGCTG -3'
(R):5'- TTTGCCAGGATTACAGGCAC -3'

Posted On

2014-10-01