Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Zfp592'

235351

Institutional Source

Beutler Lab

Gene Symbol

Zfp592

Ensembl Gene

ENSMUSG00000005621

Gene Name

zinc finger protein 592

Synonyms

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80993681-81045164 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81041438 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1122 (S1122P)

Ref Sequence

ENSEMBL: ENSMUSP00000102976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107353]

AlphaFold

Q8BHZ4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107353
AA Change: S1122P

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: S1122P

Domain	Start	End	E-Value	Type
low complexity region	170	180	N/A	INTRINSIC
low complexity region	200	211	N/A	INTRINSIC
low complexity region	314	333	N/A	INTRINSIC
low complexity region	343	369	N/A	INTRINSIC
low complexity region	484	500	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
ZnF_C2H2	587	612	8.98e0	SMART
ZnF_C2H2	615	639	2.61e1	SMART
low complexity region	664	686	N/A	INTRINSIC
ZnF_C2H2	711	731	1.24e2	SMART
ZnF_C2H2	740	762	2.82e0	SMART
ZnF_C2H2	768	792	4.99e1	SMART
ZnF_C2H2	799	822	1.73e0	SMART
ZnF_C2H2	827	850	7.89e0	SMART
ZnF_C2H2	892	915	3.89e-3	SMART
low complexity region	924	935	N/A	INTRINSIC
low complexity region	965	979	N/A	INTRINSIC
ZnF_C2H2	983	1006	4.11e-2	SMART
ZnF_C2H2	1013	1036	7.37e-4	SMART
ZnF_C2H2	1043	1069	7.68e0	SMART
ZnF_C2H2	1124	1146	1.51e0	SMART
ZnF_C2H2	1153	1176	1.23e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125137

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149508

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het

Other mutations in Zfp592

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Zfp592	APN	7	81041548	nonsense	probably null
IGL01984:Zfp592	APN	7	81038644	missense	probably benign	0.00
IGL02079:Zfp592	APN	7	81039230	missense	probably benign	0.20
IGL02096:Zfp592	APN	7	81025048	missense	probably damaging	1.00
IGL02125:Zfp592	APN	7	81038184	missense	probably benign	0.00
IGL02374:Zfp592	APN	7	81024983	missense	probably damaging	1.00
IGL02419:Zfp592	APN	7	81038245	missense	probably damaging	1.00
IGL02466:Zfp592	APN	7	81023998	missense	probably damaging	1.00
IGL02485:Zfp592	APN	7	81037970	splice site	probably benign
IGL02500:Zfp592	APN	7	81041726	missense	probably benign
IGL02876:Zfp592	APN	7	81038127	missense	probably benign	0.01
IGL02940:Zfp592	APN	7	81024827	missense	probably damaging	1.00
R0326:Zfp592	UTSW	7	81024889	missense	possibly damaging	0.83
R0634:Zfp592	UTSW	7	81038071	missense	probably damaging	1.00
R0684:Zfp592	UTSW	7	81037875	missense	probably benign	0.00
R0750:Zfp592	UTSW	7	81024745	missense	probably benign
R1346:Zfp592	UTSW	7	81038064	missense	possibly damaging	0.54
R1457:Zfp592	UTSW	7	81024479	missense	probably damaging	0.99
R1650:Zfp592	UTSW	7	81038100	missense	probably benign	0.04
R1804:Zfp592	UTSW	7	81023695	missense	probably damaging	1.00
R1918:Zfp592	UTSW	7	81037420	nonsense	probably null
R2114:Zfp592	UTSW	7	81024796	missense	probably damaging	1.00
R2144:Zfp592	UTSW	7	81038202	missense	probably benign	0.01
R2246:Zfp592	UTSW	7	81041613	missense	possibly damaging	0.91
R3701:Zfp592	UTSW	7	81037411	nonsense	probably null
R3809:Zfp592	UTSW	7	81024532	missense	probably benign	0.00
R4574:Zfp592	UTSW	7	81023786	missense	possibly damaging	0.87
R4866:Zfp592	UTSW	7	81041859	missense	probably damaging	1.00
R5023:Zfp592	UTSW	7	81024347	missense	probably damaging	1.00
R5121:Zfp592	UTSW	7	81023561	missense	probably damaging	1.00
R5174:Zfp592	UTSW	7	81038325	missense	probably damaging	1.00
R5794:Zfp592	UTSW	7	81025033	missense	probably benign	0.00
R5946:Zfp592	UTSW	7	81037897	missense	possibly damaging	0.95
R6312:Zfp592	UTSW	7	81023436	missense	probably benign	0.05
R6657:Zfp592	UTSW	7	81025486	missense	possibly damaging	0.49
R6814:Zfp592	UTSW	7	81023828	missense	probably benign	0.02
R6872:Zfp592	UTSW	7	81023828	missense	probably benign	0.02
R7056:Zfp592	UTSW	7	81023319	missense	probably damaging	1.00
R7295:Zfp592	UTSW	7	81024322	missense	probably damaging	1.00
R7351:Zfp592	UTSW	7	81041691	missense	probably benign	0.00
R7475:Zfp592	UTSW	7	81023452	missense	probably damaging	0.99
R7509:Zfp592	UTSW	7	81038340	missense	probably damaging	0.99
R7552:Zfp592	UTSW	7	81023642	missense	probably benign	0.01
R7737:Zfp592	UTSW	7	81025193	missense	probably damaging	1.00
R7752:Zfp592	UTSW	7	81024721	missense	probably benign	0.13
R7901:Zfp592	UTSW	7	81024721	missense	probably benign	0.13
R8100:Zfp592	UTSW	7	81024192	missense	probably benign	0.05
R8440:Zfp592	UTSW	7	81041523	missense	possibly damaging	0.89
R8710:Zfp592	UTSW	7	81023573	missense	probably damaging	1.00
R8766:Zfp592	UTSW	7	81024605	missense	probably benign	0.00
R9083:Zfp592	UTSW	7	81024896	missense	possibly damaging	0.95
R9141:Zfp592	UTSW	7	81024457	missense	probably damaging	1.00
R9194:Zfp592	UTSW	7	81024601	missense	probably benign
R9197:Zfp592	UTSW	7	81024319	missense	possibly damaging	0.73
R9246:Zfp592	UTSW	7	81041781	missense	probably benign	0.03
R9321:Zfp592	UTSW	7	81041478	missense	possibly damaging	0.65
R9426:Zfp592	UTSW	7	81024457	missense	probably damaging	1.00
R9785:Zfp592	UTSW	7	81023497	missense	probably damaging	1.00
X0022:Zfp592	UTSW	7	81038187	nonsense	probably null
X0028:Zfp592	UTSW	7	81024014	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGTGAGTACAGAACACTG -3'
(R):5'- ACTTTGTGGACTATGAACAGGTG -3'

Sequencing Primer
(F):5'- CAGCAGTTAAGAACTCGTCCTGTG -3'
(R):5'- ACTATGAACAGGTGGCGGTTG -3'

Posted On

2014-10-01