Incidental Mutation 'R2164:Ldaf1'
ID 235353
Institutional Source Beutler Lab
Gene Symbol Ldaf1
Ensembl Gene ENSMUSG00000030917
Gene Name lipid droplet assembly factor 1
Synonyms Tmem159, 8430420C20Rik
MMRRC Submission 040167-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119701599-119720212 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119719462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 157 (E157G)
Ref Sequence ENSEMBL: ENSMUSP00000114085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033210] [ENSMUST00000118737]
AlphaFold Q922Z1
Predicted Effect possibly damaging
Transcript: ENSMUST00000033210
AA Change: E157G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033210
Gene: ENSMUSG00000030917
AA Change: E157G

DomainStartEndE-ValueType
Pfam:Promethin 20 128 2.4e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118737
AA Change: E157G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114085
Gene: ENSMUSG00000030917
AA Change: E157G

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,101,019 (GRCm39) probably null Het
Adcy8 C T 15: 64,792,783 (GRCm39) G58S probably benign Het
Adgra2 T A 8: 27,604,232 (GRCm39) L24* probably null Het
Ampd2 C A 3: 107,992,685 (GRCm39) probably benign Het
Ankrd26 T G 6: 118,502,752 (GRCm39) E806A probably damaging Het
Apol9b A G 15: 77,619,639 (GRCm39) D145G probably benign Het
Ash1l T A 3: 88,892,726 (GRCm39) M1535K probably benign Het
Atf6 A G 1: 170,622,304 (GRCm39) M439T probably damaging Het
B3glct A T 5: 149,677,621 (GRCm39) M417L probably damaging Het
Cep192 A T 18: 67,953,431 (GRCm39) T483S probably damaging Het
Cep290 G A 10: 100,354,657 (GRCm39) E914K probably damaging Het
Chst15 C T 7: 131,872,114 (GRCm39) A56T probably damaging Het
Col27a1 A T 4: 63,143,661 (GRCm39) T450S probably benign Het
Cpsf2 A G 12: 101,951,594 (GRCm39) N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Ctc1 C T 11: 68,926,441 (GRCm39) A859V possibly damaging Het
Dcakd A G 11: 102,888,183 (GRCm39) Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 (GRCm39) Y22* probably null Het
Dync2h1 T A 9: 7,124,797 (GRCm39) D2025V probably damaging Het
Dync2li1 T C 17: 84,943,702 (GRCm39) S92P probably damaging Het
Eml5 A G 12: 98,853,356 (GRCm39) V81A probably damaging Het
Espl1 C T 15: 102,228,023 (GRCm39) R1625C probably damaging Het
Fam181a T C 12: 103,282,785 (GRCm39) V230A probably benign Het
Fanci T A 7: 79,045,743 (GRCm39) D28E probably benign Het
Fmn1 A G 2: 113,195,962 (GRCm39) N554S unknown Het
Frem2 T C 3: 53,444,751 (GRCm39) Y2460C probably damaging Het
Fscb G A 12: 64,520,567 (GRCm39) P300S probably damaging Het
Gm28042 A G 2: 119,867,229 (GRCm39) D438G probably benign Het
Map1b C T 13: 99,565,846 (GRCm39) V2292M unknown Het
Nbas A G 12: 13,380,647 (GRCm39) D635G possibly damaging Het
Ncapg2 A G 12: 116,414,095 (GRCm39) probably null Het
Nrp2 A T 1: 62,783,514 (GRCm39) E205V probably damaging Het
Pcdhb3 A T 18: 37,435,239 (GRCm39) T402S possibly damaging Het
Phc1 T C 6: 122,299,296 (GRCm39) N638D possibly damaging Het
Plcb1 A G 2: 135,188,250 (GRCm39) N781S possibly damaging Het
Prkdc T A 16: 15,523,071 (GRCm39) D1164E probably damaging Het
Proser2 T A 2: 6,105,506 (GRCm39) R353W possibly damaging Het
Prxl2b T G 4: 154,982,606 (GRCm39) Y56S probably damaging Het
Ptges T A 2: 30,782,708 (GRCm39) T115S probably benign Het
Ptprk A T 10: 28,436,138 (GRCm39) D833V probably damaging Het
Pum1 T A 4: 130,455,394 (GRCm39) L173* probably null Het
Pum1 G T 4: 130,455,395 (GRCm39) L269F probably damaging Het
Rasgrp4 A G 7: 28,838,470 (GRCm39) Y106C probably damaging Het
Rbbp6 T A 7: 122,598,697 (GRCm39) probably benign Het
Rdh1 A G 10: 127,596,041 (GRCm39) T79A possibly damaging Het
Relb A C 7: 19,347,686 (GRCm39) probably null Het
Rnf122 G A 8: 31,602,192 (GRCm39) W6* probably null Het
Rnf31 A G 14: 55,829,994 (GRCm39) E138G possibly damaging Het
Scaf8 G A 17: 3,247,485 (GRCm39) R936Q probably damaging Het
Scube3 T A 17: 28,385,108 (GRCm39) V686D possibly damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Spns2 C T 11: 72,349,497 (GRCm39) V252M possibly damaging Het
Tomm40l C T 1: 171,047,703 (GRCm39) S220N probably damaging Het
Trim17 A G 11: 58,862,237 (GRCm39) D423G probably damaging Het
Trpc6 A AT 9: 8,610,466 (GRCm39) probably null Het
Tut4 G A 4: 108,360,226 (GRCm39) R481Q possibly damaging Het
Uba5 A T 9: 103,937,442 (GRCm39) M89K probably damaging Het
Vav2 T C 2: 27,163,718 (GRCm39) D628G probably damaging Het
Vmn2r107 T C 17: 20,595,904 (GRCm39) L819P probably damaging Het
Vmn2r25 A T 6: 123,816,518 (GRCm39) D354E possibly damaging Het
Xrn1 A G 9: 95,888,873 (GRCm39) E984G possibly damaging Het
Zbtb17 T C 4: 141,191,557 (GRCm39) V223A probably benign Het
Zfp592 T C 7: 80,691,186 (GRCm39) S1122P possibly damaging Het
Other mutations in Ldaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4405:Ldaf1 UTSW 7 119,714,714 (GRCm39) missense probably damaging 1.00
R4937:Ldaf1 UTSW 7 119,715,535 (GRCm39) missense probably damaging 1.00
R6437:Ldaf1 UTSW 7 119,715,584 (GRCm39) splice site probably null
R7608:Ldaf1 UTSW 7 119,704,011 (GRCm39) missense probably damaging 0.97
R7748:Ldaf1 UTSW 7 119,714,702 (GRCm39) missense possibly damaging 0.94
Z1176:Ldaf1 UTSW 7 119,714,714 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGGGAAGGAGCTCACAG -3'
(R):5'- CACTCTGCTAAGGTCAAGGC -3'

Sequencing Primer
(F):5'- TTCTAGGGAAGGAGCTCACAGAAAAC -3'
(R):5'- TCTGCTAAGGTCAAGGCTGCATAC -3'
Posted On 2014-10-01