Incidental Mutation 'R2164:Rbbp6'
Institutional Source Beutler Lab
Gene Symbol Rbbp6
Ensembl Gene ENSMUSG00000030779
Gene Nameretinoblastoma binding protein 6, ubiquitin ligase
SynonymsC030034J04Rik, 4933422O15Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosomal Location122965686-123002557 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 122999474 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052135] [ENSMUST00000071590] [ENSMUST00000205495] [ENSMUST00000231323]
Predicted Effect unknown
Transcript: ENSMUST00000052135
AA Change: S1003T
SMART Domains Protein: ENSMUSP00000049528
Gene: ENSMUSG00000030779
AA Change: S1003T

DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
coiled coil region 653 679 N/A INTRINSIC
low complexity region 680 774 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
internal_repeat_2 1026 1091 4.38e-6 PROSPERO
internal_repeat_1 1038 1107 3.76e-7 PROSPERO
low complexity region 1120 1141 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1247 1258 N/A INTRINSIC
internal_repeat_2 1395 1466 4.38e-6 PROSPERO
low complexity region 1472 1490 N/A INTRINSIC
internal_repeat_1 1523 1586 3.76e-7 PROSPERO
low complexity region 1689 1752 N/A INTRINSIC
low complexity region 1758 1784 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000071590
AA Change: S969T
SMART Domains Protein: ENSMUSP00000071519
Gene: ENSMUSG00000030779
AA Change: S969T

DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
low complexity region 653 740 N/A INTRINSIC
low complexity region 790 810 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 969 991 N/A INTRINSIC
internal_repeat_2 992 1057 5.65e-6 PROSPERO
internal_repeat_1 1004 1073 5.01e-7 PROSPERO
low complexity region 1086 1107 N/A INTRINSIC
low complexity region 1109 1120 N/A INTRINSIC
low complexity region 1213 1224 N/A INTRINSIC
internal_repeat_2 1361 1432 5.65e-6 PROSPERO
low complexity region 1438 1456 N/A INTRINSIC
internal_repeat_1 1489 1552 5.01e-7 PROSPERO
low complexity region 1655 1718 N/A INTRINSIC
low complexity region 1724 1750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206967
Predicted Effect unknown
Transcript: ENSMUST00000231323
AA Change: S1041T
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, reduced size, growth retardation and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Rbbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Rbbp6 APN 7 122988685 missense probably damaging 1.00
IGL00561:Rbbp6 APN 7 122971063 missense probably damaging 1.00
IGL01144:Rbbp6 APN 7 122975946 missense possibly damaging 0.95
IGL01325:Rbbp6 APN 7 122988618 missense probably damaging 1.00
IGL01520:Rbbp6 APN 7 122985675 missense possibly damaging 0.93
IGL01765:Rbbp6 APN 7 122999954 unclassified probably benign
IGL01985:Rbbp6 APN 7 122971073 missense probably damaging 1.00
IGL02094:Rbbp6 APN 7 122997262 missense probably damaging 1.00
IGL02125:Rbbp6 APN 7 122971129 critical splice donor site probably null
IGL02552:Rbbp6 APN 7 122982981 missense probably damaging 0.98
IGL02805:Rbbp6 APN 7 123001188 utr 3 prime probably benign
changeling UTSW 7 122997311 splice site probably null
Puzzlewit UTSW 7 122999808 unclassified probably benign
R0403:Rbbp6 UTSW 7 122992296 missense probably damaging 0.99
R0855:Rbbp6 UTSW 7 122992248 missense probably benign 0.22
R1132:Rbbp6 UTSW 7 123000113 unclassified probably benign
R1463:Rbbp6 UTSW 7 122992453 missense possibly damaging 0.89
R1867:Rbbp6 UTSW 7 122997029 missense probably damaging 1.00
R1957:Rbbp6 UTSW 7 122990288 missense probably benign 0.04
R1958:Rbbp6 UTSW 7 123001945 unclassified probably benign
R1978:Rbbp6 UTSW 7 122999488 unclassified probably benign
R1999:Rbbp6 UTSW 7 122990352 missense probably damaging 0.98
R4181:Rbbp6 UTSW 7 122994735 missense probably damaging 0.99
R4387:Rbbp6 UTSW 7 122997311 splice site probably null
R4583:Rbbp6 UTSW 7 123001952 unclassified probably benign
R4936:Rbbp6 UTSW 7 122999703 unclassified probably benign
R4974:Rbbp6 UTSW 7 122999808 unclassified probably benign
R4998:Rbbp6 UTSW 7 122990326 missense probably benign 0.36
R5082:Rbbp6 UTSW 7 123000702 utr 3 prime probably benign
R5502:Rbbp6 UTSW 7 122988724 missense probably damaging 1.00
R5567:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5570:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5607:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5608:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5948:Rbbp6 UTSW 7 122997628 missense probably damaging 1.00
R6134:Rbbp6 UTSW 7 122997311 splice site probably null
R6172:Rbbp6 UTSW 7 122998555 nonsense probably null
R6773:Rbbp6 UTSW 7 122999355 unclassified probably benign
R6800:Rbbp6 UTSW 7 122985064 missense possibly damaging 0.93
R7266:Rbbp6 UTSW 7 123001367 missense unknown
R7298:Rbbp6 UTSW 7 123001194 missense unknown
R7535:Rbbp6 UTSW 7 122990143 missense probably benign 0.00
R7635:Rbbp6 UTSW 7 122976008 missense possibly damaging 0.80
R7665:Rbbp6 UTSW 7 122994686 missense possibly damaging 0.81
R7665:Rbbp6 UTSW 7 122990032 splice site probably null
R7910:Rbbp6 UTSW 7 122997028 missense possibly damaging 0.48
R7956:Rbbp6 UTSW 7 123001338 missense unknown
R8043:Rbbp6 UTSW 7 122985245 missense probably damaging 1.00
R8273:Rbbp6 UTSW 7 122990324 missense probably benign 0.36
R8473:Rbbp6 UTSW 7 123001198 utr 3 prime probably benign
R8679:Rbbp6 UTSW 7 123001293 missense unknown
R8712:Rbbp6 UTSW 7 123001753 missense unknown
R8911:Rbbp6 UTSW 7 122992045 missense possibly damaging 0.53
X0062:Rbbp6 UTSW 7 123000146 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01