Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Adgra2'

235358

Institutional Source

Beutler Lab

Gene Symbol

Adgra2

Ensembl Gene

ENSMUSG00000031486

Gene Name

adhesion G protein-coupled receptor A2

Synonyms

Tem5, 8430414O08Rik, Gpr124, 9530074E10Rik

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27085583-27123436 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 27114204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 24 (L24*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514] [ENSMUST00000179351]

AlphaFold

Q91ZV8

Predicted Effect

probably null
Transcript: ENSMUST00000033876
AA Change: L474*

SMART Domains

Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486
AA Change: L474*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LRR	82	106	1.06e2	SMART
LRR_TYP	107	130	2.71e-2	SMART
LRR_TYP	131	154	1.28e-3	SMART
LRR	155	178	7.38e1	SMART
LRRCT	190	240	4.63e-6	SMART
IG	253	346	3.49e-3	SMART
low complexity region	629	639	N/A	INTRINSIC
low complexity region	663	674	N/A	INTRINSIC
Pfam:GPS	709	750	1.1e-7	PFAM
Pfam:7tm_2	770	990	5.3e-13	PFAM
transmembrane domain	1016	1038	N/A	INTRINSIC
transmembrane domain	1045	1064	N/A	INTRINSIC
low complexity region	1075	1095	N/A	INTRINSIC
low complexity region	1110	1129	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000178514
AA Change: L474*

SMART Domains

Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486
AA Change: L474*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LRR	82	106	4.4e-1	SMART
LRR_TYP	107	130	1.1e-4	SMART
LRR_TYP	131	154	5.3e-6	SMART
LRR	155	178	3.1e-1	SMART
LRRCT	190	240	2.2e-8	SMART
IG	253	346	1.4e-5	SMART
HormR	349	426	1.8e-4	SMART
Pfam:7tm_2	554	775	3.2e-11	PFAM
transmembrane domain	801	823	N/A	INTRINSIC
transmembrane domain	830	849	N/A	INTRINSIC
low complexity region	860	880	N/A	INTRINSIC
low complexity region	895	914	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179207
AA Change: L24*

Predicted Effect

probably benign
Transcript: ENSMUST00000179351

SMART Domains

Protein: ENSMUSP00000137457
Gene: ENSMUSG00000031486

Domain	Start	End	E-Value	Type
Pfam:GPS	5	49	4.5e-11	PFAM
transmembrane domain	67	89	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Adgra2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00910:Adgra2	APN	8	27085983	missense	possibly damaging	0.81
IGL01599:Adgra2	APN	8	27118733	missense	possibly damaging	0.67
IGL01627:Adgra2	APN	8	27118733	missense	possibly damaging	0.67
IGL01629:Adgra2	APN	8	27118733	missense	possibly damaging	0.67
IGL01632:Adgra2	APN	8	27118733	missense	possibly damaging	0.67
IGL01968:Adgra2	APN	8	27121235	nonsense	probably null
IGL02551:Adgra2	APN	8	27119222	missense	probably benign
IGL02820:Adgra2	APN	8	27117507	missense	probably damaging	1.00
R0735:Adgra2	UTSW	8	27117318	missense	probably damaging	1.00
R0799:Adgra2	UTSW	8	27112495	missense	probably damaging	1.00
R1183:Adgra2	UTSW	8	27114388	missense	probably damaging	1.00
R1276:Adgra2	UTSW	8	27119824	missense	probably damaging	0.99
R1389:Adgra2	UTSW	8	27111088	missense	probably damaging	1.00
R1514:Adgra2	UTSW	8	27121278	nonsense	probably null
R1601:Adgra2	UTSW	8	27110018	splice site	probably null
R1760:Adgra2	UTSW	8	27119767	missense	probably damaging	1.00
R1957:Adgra2	UTSW	8	27111168	missense	possibly damaging	0.64
R1977:Adgra2	UTSW	8	27115761	missense	possibly damaging	0.80
R2181:Adgra2	UTSW	8	27121673	missense	probably damaging	0.99
R4282:Adgra2	UTSW	8	27119244	missense	possibly damaging	0.54
R4724:Adgra2	UTSW	8	27098822	missense	possibly damaging	0.91
R4749:Adgra2	UTSW	8	27114197	missense	probably damaging	1.00
R4809:Adgra2	UTSW	8	27110479	nonsense	probably null
R5718:Adgra2	UTSW	8	27113486	critical splice donor site	probably null
R6025:Adgra2	UTSW	8	27114463	missense	probably damaging	0.99
R6078:Adgra2	UTSW	8	27114429	missense	probably damaging	1.00
R6079:Adgra2	UTSW	8	27114429	missense	probably damaging	1.00
R6138:Adgra2	UTSW	8	27114429	missense	probably damaging	1.00
R6140:Adgra2	UTSW	8	27115405	missense	probably damaging	1.00
R6232:Adgra2	UTSW	8	27119165	missense	probably benign	0.19
R6321:Adgra2	UTSW	8	27114162	missense	probably benign	0.02
R6385:Adgra2	UTSW	8	27118850	missense	probably damaging	1.00
R6676:Adgra2	UTSW	8	27111240	missense	possibly damaging	0.50
R6724:Adgra2	UTSW	8	27114182	missense	possibly damaging	0.93
R6862:Adgra2	UTSW	8	27113436	missense	probably benign	0.01
R6862:Adgra2	UTSW	8	27113437	missense	probably damaging	0.98
R7140:Adgra2	UTSW	8	27120901	critical splice donor site	probably null
R7242:Adgra2	UTSW	8	27122027	missense	probably damaging	1.00
R7861:Adgra2	UTSW	8	27114457	missense	probably damaging	0.98
R7882:Adgra2	UTSW	8	27117412	missense	probably benign	0.15
R8069:Adgra2	UTSW	8	27119223	missense	probably benign	0.01
R8146:Adgra2	UTSW	8	27114174	missense	probably damaging	0.99
R9080:Adgra2	UTSW	8	27114501	missense	probably benign	0.02
R9103:Adgra2	UTSW	8	27113408	missense	probably damaging	1.00
R9135:Adgra2	UTSW	8	27120951	missense	probably damaging	1.00
R9425:Adgra2	UTSW	8	27086066	missense	probably benign	0.04
R9473:Adgra2	UTSW	8	27120915	missense	probably damaging	0.99
R9643:Adgra2	UTSW	8	27122003	missense	possibly damaging	0.48
R9648:Adgra2	UTSW	8	27119144	missense	probably damaging	1.00
X0050:Adgra2	UTSW	8	27113418	missense	probably benign	0.32
X0062:Adgra2	UTSW	8	27120806	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ATGTTGGCCCTGAATCCCAG -3'
(R):5'- CTCATCCACCAGCATCAGGTTG -3'

Sequencing Primer
(F):5'- CTGAATCCCAGAGGCTAGTTCTG -3'
(R):5'- CATCAGGTTGCTGGCCATGTC -3'

Posted On

2014-10-01