Incidental Mutation 'R2164:Adgra2'
ID235358
Institutional Source Beutler Lab
Gene Symbol Adgra2
Ensembl Gene ENSMUSG00000031486
Gene Nameadhesion G protein-coupled receptor A2
SynonymsTem5, 8430414O08Rik, Gpr124, 9530074E10Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27085583-27123436 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 27114204 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 24 (L24*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514] [ENSMUST00000179351]
Predicted Effect probably null
Transcript: ENSMUST00000033876
AA Change: L474*
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486
AA Change: L474*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178514
AA Change: L474*
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486
AA Change: L474*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179207
AA Change: L24*
Predicted Effect probably benign
Transcript: ENSMUST00000179351
SMART Domains Protein: ENSMUSP00000137457
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
Pfam:GPS 5 49 4.5e-11 PFAM
transmembrane domain 67 89 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Adgra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Adgra2 APN 8 27085983 missense possibly damaging 0.81
IGL01599:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01627:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01629:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01632:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01968:Adgra2 APN 8 27121235 nonsense probably null
IGL02551:Adgra2 APN 8 27119222 missense probably benign
IGL02820:Adgra2 APN 8 27117507 missense probably damaging 1.00
R0735:Adgra2 UTSW 8 27117318 missense probably damaging 1.00
R0799:Adgra2 UTSW 8 27112495 missense probably damaging 1.00
R1183:Adgra2 UTSW 8 27114388 missense probably damaging 1.00
R1276:Adgra2 UTSW 8 27119824 missense probably damaging 0.99
R1389:Adgra2 UTSW 8 27111088 missense probably damaging 1.00
R1514:Adgra2 UTSW 8 27121278 nonsense probably null
R1601:Adgra2 UTSW 8 27110018 splice site probably null
R1760:Adgra2 UTSW 8 27119767 missense probably damaging 1.00
R1957:Adgra2 UTSW 8 27111168 missense possibly damaging 0.64
R1977:Adgra2 UTSW 8 27115761 missense possibly damaging 0.80
R2181:Adgra2 UTSW 8 27121673 missense probably damaging 0.99
R4282:Adgra2 UTSW 8 27119244 missense possibly damaging 0.54
R4724:Adgra2 UTSW 8 27098822 missense possibly damaging 0.91
R4749:Adgra2 UTSW 8 27114197 missense probably damaging 1.00
R4809:Adgra2 UTSW 8 27110479 nonsense probably null
R5718:Adgra2 UTSW 8 27113486 critical splice donor site probably null
R6025:Adgra2 UTSW 8 27114463 missense probably damaging 0.99
R6078:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6079:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6138:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6140:Adgra2 UTSW 8 27115405 missense probably damaging 1.00
R6232:Adgra2 UTSW 8 27119165 missense probably benign 0.19
R6321:Adgra2 UTSW 8 27114162 missense probably benign 0.02
R6385:Adgra2 UTSW 8 27118850 missense probably damaging 1.00
R6676:Adgra2 UTSW 8 27111240 missense possibly damaging 0.50
R6724:Adgra2 UTSW 8 27114182 missense possibly damaging 0.93
R6862:Adgra2 UTSW 8 27113436 missense probably benign 0.01
R6862:Adgra2 UTSW 8 27113437 missense probably damaging 0.98
R7140:Adgra2 UTSW 8 27120901 critical splice donor site probably null
R7242:Adgra2 UTSW 8 27122027 missense probably damaging 1.00
X0050:Adgra2 UTSW 8 27113418 missense probably benign 0.32
X0062:Adgra2 UTSW 8 27120806 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATGTTGGCCCTGAATCCCAG -3'
(R):5'- CTCATCCACCAGCATCAGGTTG -3'

Sequencing Primer
(F):5'- CTGAATCCCAGAGGCTAGTTCTG -3'
(R):5'- CATCAGGTTGCTGGCCATGTC -3'
Posted On2014-10-01