Mutagenetix > Incidental Mutations

Incidental Mutation 'R2164:Trpc6'

235361

Institutional Source

Beutler Lab

Gene Symbol

Trpc6

Ensembl Gene

ENSMUSG00000031997

Gene Name

transient receptor potential cation channel, subfamily C, member 6

Synonyms

mtrp6, Trrp6

MMRRC Submission

040167-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2164 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

8544142-8680741 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to AT at 8610465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150193 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596] [ENSMUST00000217462]

AlphaFold

Q61143

Predicted Effect

probably null
Transcript: ENSMUST00000050433

SMART Domains

Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997

Domain	Start	End	E-Value	Type
low complexity region	37	54	N/A	INTRINSIC
ANK	96	125	4.73e2	SMART
ANK	131	159	3.49e0	SMART
ANK	217	246	6.61e-1	SMART
Pfam:TRP_2	252	314	4e-29	PFAM
transmembrane domain	406	427	N/A	INTRINSIC
Pfam:Ion_trans	442	738	4.2e-38	PFAM
Pfam:PKD_channel	477	733	3.1e-16	PFAM
low complexity region	770	781	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000214596

Predicted Effect

probably null
Transcript: ENSMUST00000217462

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Trpc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Trpc6	APN	9	8680438	missense	probably damaging	1.00
IGL00469:Trpc6	APN	9	8626701	missense	probably benign
IGL00970:Trpc6	APN	9	8653151	missense	probably damaging	1.00
IGL01299:Trpc6	APN	9	8653061	missense	probably damaging	1.00
IGL01563:Trpc6	APN	9	8656603	missense	probably damaging	1.00
IGL01578:Trpc6	APN	9	8634057	missense	probably damaging	1.00
IGL02657:Trpc6	APN	9	8643601	missense	possibly damaging	0.94
IGL02735:Trpc6	APN	9	8655338	missense	probably damaging	1.00
IGL03102:Trpc6	APN	9	8649301	missense	probably benign	0.07
P0038:Trpc6	UTSW	9	8649511	missense	possibly damaging	0.52
PIT4531001:Trpc6	UTSW	9	8610148	missense	probably benign	0.14
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8610275	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8643536	missense	probably damaging	1.00
R0334:Trpc6	UTSW	9	8610343	missense	probably damaging	1.00
R0665:Trpc6	UTSW	9	8634122	missense	probably benign	0.11
R0948:Trpc6	UTSW	9	8610415	missense	possibly damaging	0.60
R1177:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1217:Trpc6	UTSW	9	8658286	splice site	probably null
R1445:Trpc6	UTSW	9	8680537	missense	probably benign	0.00
R1452:Trpc6	UTSW	9	8653147	missense	probably damaging	0.99
R1494:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1501:Trpc6	UTSW	9	8610169	missense	probably damaging	0.99
R1933:Trpc6	UTSW	9	8656545	missense	probably damaging	1.00
R2112:Trpc6	UTSW	9	8656612	missense	probably damaging	1.00
R2921:Trpc6	UTSW	9	8653033	missense	possibly damaging	0.94
R2995:Trpc6	UTSW	9	8544466	missense	probably benign	0.30
R3821:Trpc6	UTSW	9	8610278	missense	probably damaging	1.00
R3965:Trpc6	UTSW	9	8626621	missense	probably damaging	1.00
R4360:Trpc6	UTSW	9	8610266	missense	probably benign	0.10
R4625:Trpc6	UTSW	9	8677962	missense	probably benign	0.40
R4691:Trpc6	UTSW	9	8652978	missense	probably damaging	1.00
R4736:Trpc6	UTSW	9	8609870	missense	probably damaging	1.00
R4767:Trpc6	UTSW	9	8643686	missense	probably damaging	1.00
R4773:Trpc6	UTSW	9	8609851	missense	possibly damaging	0.78
R4792:Trpc6	UTSW	9	8626614	missense	probably benign	0.00
R5105:Trpc6	UTSW	9	8649470	missense	probably benign
R5319:Trpc6	UTSW	9	8609921	missense	probably damaging	1.00
R5429:Trpc6	UTSW	9	8634074	nonsense	probably null
R5505:Trpc6	UTSW	9	8626735	missense	probably damaging	1.00
R5657:Trpc6	UTSW	9	8609807	missense	probably benign	0.11
R5684:Trpc6	UTSW	9	8653128	missense	probably damaging	1.00
R5722:Trpc6	UTSW	9	8680549	missense	possibly damaging	0.88
R6210:Trpc6	UTSW	9	8656730	missense	probably benign	0.42
R6284:Trpc6	UTSW	9	8643600	missense	possibly damaging	0.93
R6773:Trpc6	UTSW	9	8634057	missense	probably damaging	1.00
R6874:Trpc6	UTSW	9	8680438	missense	probably damaging	1.00
R7032:Trpc6	UTSW	9	8609950	missense	probably damaging	1.00
R7142:Trpc6	UTSW	9	8653016	nonsense	probably null
R7489:Trpc6	UTSW	9	8656544	missense	probably benign	0.00
R7631:Trpc6	UTSW	9	8626701	missense	probably benign
R7762:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91
R7872:Trpc6	UTSW	9	8609909	missense	probably damaging	1.00
R7895:Trpc6	UTSW	9	8655218	missense	probably damaging	1.00
R7911:Trpc6	UTSW	9	8656704	missense	probably benign
R8115:Trpc6	UTSW	9	8609981	missense	probably damaging	1.00
R8183:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91
R8435:Trpc6	UTSW	9	8610440	missense	probably damaging	1.00
R8929:Trpc6	UTSW	9	8643410	intron	probably benign
R9355:Trpc6	UTSW	9	8649472	missense	probably benign
Z1176:Trpc6	UTSW	9	8655213	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TACAGAATGCAGCCAGAAGC -3'
(R):5'- CATGCACAGTAATTAGCACATCATG -3'

Sequencing Primer
(F):5'- GCAGAAGCATGATTCCTTCAG -3'
(R):5'- TGGAAACACACCTTGGCTTTAC -3'

Posted On

2014-10-01