Incidental Mutation 'R2164:Uba5'
ID235363
Institutional Source Beutler Lab
Gene Symbol Uba5
Ensembl Gene ENSMUSG00000032557
Gene Nameubiquitin-like modifier activating enzyme 5
SynonymsUbe1dc1, 5730525G14Rik
MMRRC Submission 040167-MU
Accession Numbers

Genbank: NM_025692; MGI: 1913913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location104046599-104063134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104060243 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 89 (M89K)
Ref Sequence ENSEMBL: ENSMUSP00000035166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000047799] [ENSMUST00000120854] [ENSMUST00000140768] [ENSMUST00000144195] [ENSMUST00000189998]
Predicted Effect probably damaging
Transcript: ENSMUST00000035166
AA Change: M89K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557
AA Change: M89K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047799
SMART Domains Protein: ENSMUSP00000043424
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 43 307 3.5e-45 PFAM
Pfam:Acyl-CoA_dh_N 376 498 1.5e-13 PFAM
Pfam:Acyl-CoA_dh_M 502 605 1.7e-21 PFAM
Pfam:Acyl-CoA_dh_1 617 768 2.7e-36 PFAM
Pfam:Acyl-CoA_dh_2 632 743 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120854
SMART Domains Protein: ENSMUSP00000112994
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 1 188 1.1e-28 PFAM
Pfam:EcKinase 49 143 4.8e-9 PFAM
Pfam:Acyl-CoA_dh_N 257 380 8.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 385 439 2.4e-19 PFAM
Pfam:Acyl-CoA_dh_1 499 650 1.3e-37 PFAM
Pfam:Acyl-CoA_dh_2 514 632 2.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140768
AA Change: M89K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118734
Gene: ENSMUSG00000032557
AA Change: M89K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 70 101 1.5e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144195
AA Change: M89K
SMART Domains Protein: ENSMUSP00000118535
Gene: ENSMUSG00000032557
AA Change: M89K

DomainStartEndE-ValueType
Pfam:ThiF 1 119 1.9e-22 PFAM
low complexity region 220 235 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185819
Predicted Effect probably benign
Transcript: ENSMUST00000189998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191568
Predicted Effect unknown
Transcript: ENSMUST00000214222
AA Change: M75K
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E1-like ubiquitin-activating enzyme family. This protein activates ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein, via the formation of a high-energy thioester bond. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been identified on chromosome 1. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die at E12.5. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Uba5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Uba5 APN 9 104054060 splice site probably benign
IGL02891:Uba5 APN 9 104054193 splice site probably benign
IGL03182:Uba5 APN 9 104054129 missense possibly damaging 0.78
3-1:Uba5 UTSW 9 104060392 critical splice donor site probably null
PIT4810001:Uba5 UTSW 9 104055197 missense probably damaging 1.00
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0745:Uba5 UTSW 9 104049511 unclassified probably benign
R1018:Uba5 UTSW 9 104049903 missense probably benign 0.00
R1163:Uba5 UTSW 9 104055826 missense possibly damaging 0.70
R1771:Uba5 UTSW 9 104049908 missense probably damaging 1.00
R3916:Uba5 UTSW 9 104054190 missense probably damaging 1.00
R5072:Uba5 UTSW 9 104054427 missense probably damaging 1.00
R5177:Uba5 UTSW 9 104049298 missense probably benign
R5563:Uba5 UTSW 9 104049247 missense probably benign 0.18
R6606:Uba5 UTSW 9 104055221 missense probably damaging 1.00
R7258:Uba5 UTSW 9 104062933 missense unknown
R7337:Uba5 UTSW 9 104055255 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATGAGCCTTTGTCTGGAGAAAG -3'
(R):5'- TTTCCTTTAAGCCGTCTGATGG -3'

Sequencing Primer
(F):5'- CTGGAGAAAGTTATGACTCGGCCTC -3'
(R):5'- CCGTCTGATGGCATTGAAAC -3'
Posted On2014-10-01