Incidental Mutation 'R2164:Ptprk'
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28560142 bp
Amino Acid Change Aspartic acid to Valine at position 833 (D833V)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: D823V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: D823V

signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: D833V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: D823V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Predicted Effect probably benign
Transcript: ENSMUST00000219621
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01