Incidental Mutation 'R2164:Trim17'
ID 235367
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Name tripartite motif-containing 17
Synonyms terf, Rnf16
MMRRC Submission 040167-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 58954685-58973098 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58971411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 423 (D423G)
Ref Sequence ENSEMBL: ENSMUSP00000074639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
AlphaFold Q7TPM3
Predicted Effect probably benign
Transcript: ENSMUST00000047697
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075141
AA Change: D423G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: D423G

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131221
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0518:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0765:Trim17 UTSW 11 58971369 missense possibly damaging 0.73
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R4950:Trim17 UTSW 11 58970428 missense probably damaging 0.98
R5339:Trim17 UTSW 11 58954510 splice site probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5915:Trim17 UTSW 11 58968562 missense probably damaging 0.99
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7682:Trim17 UTSW 11 58966808 missense possibly damaging 0.82
R7707:Trim17 UTSW 11 58965284 nonsense probably null
R7972:Trim17 UTSW 11 58968568 missense probably benign 0.01
R8543:Trim17 UTSW 11 58971455 missense probably damaging 1.00
R8791:Trim17 UTSW 11 58971176 missense probably benign 0.00
R8894:Trim17 UTSW 11 58968710 missense probably benign 0.00
R9015:Trim17 UTSW 11 58965231 missense probably damaging 0.99
R9026:Trim17 UTSW 11 58971447 missense probably benign 0.01
R9269:Trim17 UTSW 11 58971431 missense probably damaging 1.00
R9609:Trim17 UTSW 11 58965138 missense probably damaging 1.00
Z1177:Trim17 UTSW 11 58965389 missense probably damaging 0.99
Z1186:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1186:Trim17 UTSW 11 58970446 missense probably benign
Z1187:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1187:Trim17 UTSW 11 58970446 missense probably benign
Z1188:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1188:Trim17 UTSW 11 58970446 missense probably benign
Z1189:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1189:Trim17 UTSW 11 58970446 missense probably benign
Z1190:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1190:Trim17 UTSW 11 58970446 missense probably benign
Z1191:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1191:Trim17 UTSW 11 58970446 missense probably benign
Z1192:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1192:Trim17 UTSW 11 58970446 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAATCTCACCGGGGATGC -3'
(R):5'- ATTAACTCTTAGTGCCCCAGGG -3'

Sequencing Primer
(F):5'- ATGCACTCTGGGCCTTGG -3'
(R):5'- CTTCTGGGGAACTGTGGCAC -3'
Posted On 2014-10-01