Incidental Mutation 'R2164:Eml5'
ID235374
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Nameechinoderm microtubule associated protein like 5
SynonymsC130068M19Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98786805-98901484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98887097 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 81 (V81A)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
Predicted Effect probably damaging
Transcript: ENSMUST00000065716
AA Change: V81A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V81A

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: V81A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGTAACAATGAAATCAACAAC -3'
(R):5'- GCACACTATATCACATGGAGTTTATG -3'

Sequencing Primer
(F):5'- GGAATTGAACCCAGGTCCTCTAG -3'
(R):5'- CACATGGAGTTTATGAAGTCTATAAT -3'
Posted On2014-10-01