Incidental Mutation 'R2164:Fam181a'
ID 235376
Institutional Source Beutler Lab
Gene Symbol Fam181a
Ensembl Gene ENSMUSG00000096753
Gene Name family with sequence similarity 181, member A
Synonyms EG544888
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 103310975-103317065 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103316526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 230 (V230A)
Ref Sequence ENSEMBL: ENSMUSP00000140842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021617] [ENSMUST00000149431] [ENSMUST00000179363] [ENSMUST00000189885] [ENSMUST00000191218]
AlphaFold J3QNB7
Predicted Effect probably benign
Transcript: ENSMUST00000021617
SMART Domains Protein: ENSMUSP00000021617
Gene: ENSMUSG00000021200

DomainStartEndE-ValueType
UIM 26 45 1.02e0 SMART
ANK 104 133 1.81e2 SMART
ANK 137 167 5.45e-2 SMART
ANK 171 200 5.45e-2 SMART
ANK 204 233 2.21e-2 SMART
ANK 237 266 9.13e-4 SMART
ANK 270 299 7.42e-4 SMART
ANK 303 332 1.19e-2 SMART
ANK 336 365 5.67e0 SMART
ANK 368 397 6.02e-4 SMART
ANK 410 439 3.54e-1 SMART
ANK 440 469 6.81e-3 SMART
SOCS_box 592 631 2.51e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127447
Predicted Effect probably benign
Transcript: ENSMUST00000149431
SMART Domains Protein: ENSMUSP00000117595
Gene: ENSMUSG00000021200

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
ANK 56 85 1.81e2 SMART
ANK 89 119 5.45e-2 SMART
ANK 123 152 5.45e-2 SMART
ANK 156 185 2.21e-2 SMART
ANK 189 218 9.13e-4 SMART
ANK 222 251 7.42e-4 SMART
ANK 255 284 1.19e-2 SMART
ANK 288 317 5.67e0 SMART
ANK 320 349 6.02e-4 SMART
ANK 362 391 3.54e-1 SMART
ANK 392 421 6.81e-3 SMART
SOCS_box 544 583 2.51e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179363
AA Change: V230A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136681
Gene: ENSMUSG00000096753
AA Change: V230A

DomainStartEndE-ValueType
Pfam:FAM181 1 280 9.5e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189885
SMART Domains Protein: ENSMUSP00000139607
Gene: ENSMUSG00000096753

DomainStartEndE-ValueType
Pfam:FAM181 1 159 6e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189971
Predicted Effect probably benign
Transcript: ENSMUST00000191218
AA Change: V230A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140842
Gene: ENSMUSG00000096753
AA Change: V230A

DomainStartEndE-ValueType
Pfam:FAM181 1 280 6.7e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191414
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Fam181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Fam181a UTSW 12 103316332 nonsense probably null
R3237:Fam181a UTSW 12 103316089 missense possibly damaging 0.95
R4208:Fam181a UTSW 12 103315914 missense probably damaging 1.00
R5238:Fam181a UTSW 12 103316133 missense probably benign 0.19
R5468:Fam181a UTSW 12 103316678 missense probably benign
R6268:Fam181a UTSW 12 103316544 missense possibly damaging 0.77
R6957:Fam181a UTSW 12 103316514 missense probably damaging 0.97
R7100:Fam181a UTSW 12 103315873 missense probably damaging 1.00
R7614:Fam181a UTSW 12 103316546 missense probably damaging 1.00
R8075:Fam181a UTSW 12 103316037 missense possibly damaging 0.60
R9150:Fam181a UTSW 12 103315880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGAGGCATCTTTGTATGAG -3'
(R):5'- CTGAGGGTGTTCAGCTAGAG -3'

Sequencing Primer
(F):5'- AACTGCAAGGGTCTGGAGTCC -3'
(R):5'- GCTAGAGGTAGCCAAAGACATTG -3'
Posted On 2014-10-01