Incidental Mutation 'R2164:Map1b'
ID 235377
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 040167-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99565846 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 2292 (V2292M)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: V2292M
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: V2292M

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,101,019 (GRCm39) probably null Het
Adcy8 C T 15: 64,792,783 (GRCm39) G58S probably benign Het
Adgra2 T A 8: 27,604,232 (GRCm39) L24* probably null Het
Ampd2 C A 3: 107,992,685 (GRCm39) probably benign Het
Ankrd26 T G 6: 118,502,752 (GRCm39) E806A probably damaging Het
Apol9b A G 15: 77,619,639 (GRCm39) D145G probably benign Het
Ash1l T A 3: 88,892,726 (GRCm39) M1535K probably benign Het
Atf6 A G 1: 170,622,304 (GRCm39) M439T probably damaging Het
B3glct A T 5: 149,677,621 (GRCm39) M417L probably damaging Het
Cep192 A T 18: 67,953,431 (GRCm39) T483S probably damaging Het
Cep290 G A 10: 100,354,657 (GRCm39) E914K probably damaging Het
Chst15 C T 7: 131,872,114 (GRCm39) A56T probably damaging Het
Col27a1 A T 4: 63,143,661 (GRCm39) T450S probably benign Het
Cpsf2 A G 12: 101,951,594 (GRCm39) N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Ctc1 C T 11: 68,926,441 (GRCm39) A859V possibly damaging Het
Dcakd A G 11: 102,888,183 (GRCm39) Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 (GRCm39) Y22* probably null Het
Dync2h1 T A 9: 7,124,797 (GRCm39) D2025V probably damaging Het
Dync2li1 T C 17: 84,943,702 (GRCm39) S92P probably damaging Het
Eml5 A G 12: 98,853,356 (GRCm39) V81A probably damaging Het
Espl1 C T 15: 102,228,023 (GRCm39) R1625C probably damaging Het
Fam181a T C 12: 103,282,785 (GRCm39) V230A probably benign Het
Fanci T A 7: 79,045,743 (GRCm39) D28E probably benign Het
Fmn1 A G 2: 113,195,962 (GRCm39) N554S unknown Het
Frem2 T C 3: 53,444,751 (GRCm39) Y2460C probably damaging Het
Fscb G A 12: 64,520,567 (GRCm39) P300S probably damaging Het
Gm28042 A G 2: 119,867,229 (GRCm39) D438G probably benign Het
Ldaf1 A G 7: 119,719,462 (GRCm39) E157G possibly damaging Het
Nbas A G 12: 13,380,647 (GRCm39) D635G possibly damaging Het
Ncapg2 A G 12: 116,414,095 (GRCm39) probably null Het
Nrp2 A T 1: 62,783,514 (GRCm39) E205V probably damaging Het
Pcdhb3 A T 18: 37,435,239 (GRCm39) T402S possibly damaging Het
Phc1 T C 6: 122,299,296 (GRCm39) N638D possibly damaging Het
Plcb1 A G 2: 135,188,250 (GRCm39) N781S possibly damaging Het
Prkdc T A 16: 15,523,071 (GRCm39) D1164E probably damaging Het
Proser2 T A 2: 6,105,506 (GRCm39) R353W possibly damaging Het
Prxl2b T G 4: 154,982,606 (GRCm39) Y56S probably damaging Het
Ptges T A 2: 30,782,708 (GRCm39) T115S probably benign Het
Ptprk A T 10: 28,436,138 (GRCm39) D833V probably damaging Het
Pum1 T A 4: 130,455,394 (GRCm39) L173* probably null Het
Pum1 G T 4: 130,455,395 (GRCm39) L269F probably damaging Het
Rasgrp4 A G 7: 28,838,470 (GRCm39) Y106C probably damaging Het
Rbbp6 T A 7: 122,598,697 (GRCm39) probably benign Het
Rdh1 A G 10: 127,596,041 (GRCm39) T79A possibly damaging Het
Relb A C 7: 19,347,686 (GRCm39) probably null Het
Rnf122 G A 8: 31,602,192 (GRCm39) W6* probably null Het
Rnf31 A G 14: 55,829,994 (GRCm39) E138G possibly damaging Het
Scaf8 G A 17: 3,247,485 (GRCm39) R936Q probably damaging Het
Scube3 T A 17: 28,385,108 (GRCm39) V686D possibly damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Spns2 C T 11: 72,349,497 (GRCm39) V252M possibly damaging Het
Tomm40l C T 1: 171,047,703 (GRCm39) S220N probably damaging Het
Trim17 A G 11: 58,862,237 (GRCm39) D423G probably damaging Het
Trpc6 A AT 9: 8,610,466 (GRCm39) probably null Het
Tut4 G A 4: 108,360,226 (GRCm39) R481Q possibly damaging Het
Uba5 A T 9: 103,937,442 (GRCm39) M89K probably damaging Het
Vav2 T C 2: 27,163,718 (GRCm39) D628G probably damaging Het
Vmn2r107 T C 17: 20,595,904 (GRCm39) L819P probably damaging Het
Vmn2r25 A T 6: 123,816,518 (GRCm39) D354E possibly damaging Het
Xrn1 A G 9: 95,888,873 (GRCm39) E984G possibly damaging Het
Zbtb17 T C 4: 141,191,557 (GRCm39) V223A probably benign Het
Zfp592 T C 7: 80,691,186 (GRCm39) S1122P possibly damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGTCTTCCCAGCAAAAGGACAG -3'
(R):5'- TTGGCCGTTGATCAGAACCTAG -3'

Sequencing Primer
(F):5'- TTCCCAGCAAAAGGACAGACAGAG -3'
(R):5'- CCGTTGATCAGAACCTAGGCAAG -3'
Posted On 2014-10-01