Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Rnf31'

235378

Institutional Source

Beutler Lab

Gene Symbol

Rnf31

Ensembl Gene

ENSMUSG00000047098

Gene Name

ring finger protein 31

Synonyms

Paul, HOIP

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55591708-55603693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55592537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 138 (E138G)

Ref Sequence

ENSEMBL: ENSMUSP00000019443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000111378] [ENSMUST00000137296] [ENSMUST00000159687] [ENSMUST00000161807]

AlphaFold

Q924T7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019443
AA Change: E138G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098
AA Change: E138G

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	68	148	7.1e-17	PFAM
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	405	429	4.86e-1	SMART
Pfam:HOIP-UBA	477	622	2.4e-54	PFAM
Blast:RING	693	741	7e-25	BLAST
IBR	773	835	3.18e-14	SMART
IBR	847	924	5.35e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111378

SMART Domains

Protein: ENSMUSP00000107009
Gene: ENSMUSG00000079197

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	1	64	2.2e-26	PFAM
Pfam:PA28_beta	82	231	1.7e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126544

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137296

SMART Domains

Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	66	151	6.8e-17	PFAM
Blast:RING	214	257	3e-17	BLAST
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	404	428	4.86e-1	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000140178
AA Change: E39G

SMART Domains

Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098
AA Change: E39G

Domain	Start	End	E-Value	Type
PDB:4OYJ\|M	2	85	1e-29	PDB
low complexity region	164	196	N/A	INTRINSIC
ZnF_RBZ	200	224	2.56e-1	SMART
ZnF_RBZ	248	272	6.93e-5	SMART
ZnF_RBZ	307	331	4.86e-1	SMART
Pfam:HOIP-UBA	369	468	1.1e-31	PFAM
Blast:RING	539	587	9e-25	BLAST
IBR	619	681	3.18e-14	SMART
IBR	693	770	5.35e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159282

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159297

Predicted Effect

probably benign
Transcript: ENSMUST00000159687

SMART Domains

Protein: ENSMUSP00000125596
Gene: ENSMUSG00000079197

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	1	64	1.2e-26	PFAM
Pfam:PA28_beta	82	165	3e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162700

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162496

Predicted Effect

probably benign
Transcript: ENSMUST00000161807

SMART Domains

Protein: ENSMUSP00000123798
Gene: ENSMUSG00000079197

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	11	71	1.2e-26	PFAM
Pfam:PA28_beta	93	237	5.3e-58	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227664

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Rnf31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rnf31	APN	14	55592319	splice site	probably null
IGL01532:Rnf31	APN	14	55602623	missense	probably damaging	0.99
IGL02118:Rnf31	APN	14	55599112	missense	probably damaging	1.00
IGL02272:Rnf31	APN	14	55598782	missense	probably damaging	1.00
IGL02893:Rnf31	APN	14	55599109	missense	probably damaging	1.00
IGL02939:Rnf31	APN	14	55595674	missense	probably benign	0.30
R0285:Rnf31	UTSW	14	55601389	missense	probably damaging	0.96
R0678:Rnf31	UTSW	14	55601713	nonsense	probably null
R0924:Rnf31	UTSW	14	55593002	unclassified	probably benign
R1386:Rnf31	UTSW	14	55596764	missense	probably damaging	1.00
R1507:Rnf31	UTSW	14	55598982	nonsense	probably null
R2122:Rnf31	UTSW	14	55596197	missense	probably damaging	1.00
R3714:Rnf31	UTSW	14	55603394	missense	probably damaging	1.00
R3921:Rnf31	UTSW	14	55601142	missense	probably damaging	1.00
R4348:Rnf31	UTSW	14	55601098	frame shift	probably null
R4349:Rnf31	UTSW	14	55601098	frame shift	probably null
R4350:Rnf31	UTSW	14	55601098	frame shift	probably null
R4351:Rnf31	UTSW	14	55601098	frame shift	probably null
R4353:Rnf31	UTSW	14	55601098	frame shift	probably null
R4472:Rnf31	UTSW	14	55603320	missense	probably damaging	1.00
R5004:Rnf31	UTSW	14	55592182	missense	probably damaging	1.00
R5245:Rnf31	UTSW	14	55601706	missense	probably damaging	1.00
R5286:Rnf31	UTSW	14	55592236	missense	probably damaging	1.00
R5669:Rnf31	UTSW	14	55596704	missense	probably damaging	1.00
R5750:Rnf31	UTSW	14	55598686	missense	probably damaging	1.00
R6377:Rnf31	UTSW	14	55595527	missense	probably damaging	1.00
R7009:Rnf31	UTSW	14	55592551	missense	probably benign	0.00
R7018:Rnf31	UTSW	14	55592233	missense	probably damaging	1.00
R7670:Rnf31	UTSW	14	55594361	missense	probably benign	0.08
R7876:Rnf31	UTSW	14	55593077	critical splice donor site	probably null
R8490:Rnf31	UTSW	14	55596109	missense	probably damaging	1.00
R8818:Rnf31	UTSW	14	55594939	missense	probably benign	0.10
R8900:Rnf31	UTSW	14	55596232	missense	probably damaging	1.00
R9246:Rnf31	UTSW	14	55596241	missense	probably benign	0.01
R9454:Rnf31	UTSW	14	55596152	missense
R9526:Rnf31	UTSW	14	55598812	critical splice donor site	probably null
R9756:Rnf31	UTSW	14	55599125	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGGACTAGACCTGTGCTTAG -3'
(R):5'- TAACAGAAGCTTCCAGGCTGG -3'

Sequencing Primer
(F):5'- CTGTGCTTAGGGTTGACCAGAAAG -3'
(R):5'- TGCAGCAACAGAATTTCCCTG -3'

Posted On

2014-10-01