Incidental Mutation 'R2164:Adcy8'
ID 235381
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Name adenylate cyclase 8
Synonyms AC8
MMRRC Submission 040167-MU
Accession Numbers

Genbank: NM_009623; MGI: 1341110
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R2164 (G1)
Quality Score 150
Status Not validated
Chromosome 15
Chromosomal Location 64697084-64922296 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 64920934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 58 (G58S)
Ref Sequence ENSEMBL: ENSMUSP00000154029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000180105] [ENSMUST00000228014]
AlphaFold P97490
Predicted Effect probably benign
Transcript: ENSMUST00000023007
AA Change: G58S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: G58S

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180105
SMART Domains Protein: ENSMUSP00000136962
Gene: ENSMUSG00000094296

DomainStartEndE-ValueType
low complexity region 60 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228014
AA Change: G58S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228109
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 splice site probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64921033 missense probably benign
R7644:Adcy8 UTSW 15 64699369 missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64747001 missense probably benign
R7735:Adcy8 UTSW 15 64783780 missense probably benign 0.10
R7789:Adcy8 UTSW 15 64871774 nonsense probably null
R7860:Adcy8 UTSW 15 64699473 missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64920205 missense possibly damaging 0.60
R7948:Adcy8 UTSW 15 64815350 missense possibly damaging 0.80
R7966:Adcy8 UTSW 15 64702090 missense probably damaging 1.00
R8024:Adcy8 UTSW 15 64920246 missense probably damaging 1.00
R8097:Adcy8 UTSW 15 64871862 splice site probably null
R8158:Adcy8 UTSW 15 64783806 missense probably benign 0.32
R8463:Adcy8 UTSW 15 64921025 missense probably benign
R8474:Adcy8 UTSW 15 64704789 missense probably damaging 0.98
R8696:Adcy8 UTSW 15 64815386 missense probably benign 0.30
R8955:Adcy8 UTSW 15 64704705 missense possibly damaging 0.92
R8973:Adcy8 UTSW 15 64699135 makesense probably null
R9015:Adcy8 UTSW 15 64725357 intron probably benign
R9041:Adcy8 UTSW 15 64737438 missense probably benign 0.31
R9052:Adcy8 UTSW 15 64920915 missense probably benign 0.00
R9074:Adcy8 UTSW 15 64702091 missense probably damaging 0.96
R9183:Adcy8 UTSW 15 64822267 missense probably damaging 0.98
R9259:Adcy8 UTSW 15 64704755 missense probably damaging 1.00
R9498:Adcy8 UTSW 15 64920196 missense possibly damaging 0.88
R9522:Adcy8 UTSW 15 64920711 missense probably damaging 0.99
R9800:Adcy8 UTSW 15 64699246 missense probably benign 0.19
Z1176:Adcy8 UTSW 15 64725518 missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64699177 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACTTGGGGCACAGTCAAG -3'
(R):5'- ACAACCAGTGTCTGTGCCTC -3'

Sequencing Primer
(F):5'- TGTAGGAAGCCCAAGTCGC -3'
(R):5'- CGCGGACCCAAGCCATG -3'
Posted On 2014-10-01