Incidental Mutation 'R2164:Prkdc'
ID 235384
Institutional Source Beutler Lab
Gene Symbol Prkdc
Ensembl Gene ENSMUSG00000022672
Gene Name protein kinase, DNA activated, catalytic polypeptide
Synonyms slip, DOXNPH, DNA-PKcs, XRCC7, dxnph, DNA-PK, DNAPDcs
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 15637866-15842235 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15705207 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1164 (D1164E)
Ref Sequence ENSEMBL: ENSMUSP00000023352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023352]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023352
AA Change: D1164E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672
AA Change: D1164E

low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of the DNA-dependent protein kinase (DNA-PK). It functions with the Ku70/Ku80 heterodimer protein in DNA double strand break repair and recombination. The protein encoded is a member of the PI3/PI4-kinase family.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mutations at this locus effect genome stability, radiation sensitivity and DNA repair. Nonsense (scid) and null homozygotes have severe combined immunodeficiency. A BALB/c variant allele reduces enzyme activity and predisposes to breast cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Prkdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Prkdc APN 16 15697226 missense probably damaging 1.00
IGL00225:Prkdc APN 16 15809644 missense possibly damaging 0.64
IGL00481:Prkdc APN 16 15790466 missense probably benign 0.41
IGL00488:Prkdc APN 16 15775847 splice site probably null
IGL00489:Prkdc APN 16 15799926 missense possibly damaging 0.51
IGL00579:Prkdc APN 16 15664239 missense probably damaging 1.00
IGL00587:Prkdc APN 16 15652358 splice site probably benign
IGL00666:Prkdc APN 16 15736835 missense probably damaging 1.00
IGL00675:Prkdc APN 16 15787158 missense probably benign 0.05
IGL00708:Prkdc APN 16 15779426 missense probably damaging 0.97
IGL00725:Prkdc APN 16 15816639 missense probably benign 0.10
IGL00818:Prkdc APN 16 15759754 missense possibly damaging 0.92
IGL00917:Prkdc APN 16 15739564 missense probably damaging 0.98
IGL00990:Prkdc APN 16 15702115 missense probably benign 0.03
IGL01126:Prkdc APN 16 15669321 missense probably benign 0.01
IGL01141:Prkdc APN 16 15726704 missense probably damaging 0.99
IGL01306:Prkdc APN 16 15667731 missense possibly damaging 0.67
IGL01326:Prkdc APN 16 15829692 missense probably benign
IGL01335:Prkdc APN 16 15816896 critical splice donor site probably null
IGL01419:Prkdc APN 16 15835166 missense probably damaging 1.00
IGL01434:Prkdc APN 16 15713587 missense probably benign 0.00
IGL01554:Prkdc APN 16 15652302 missense probably benign 0.05
IGL01671:Prkdc APN 16 15667745 missense possibly damaging 0.90
IGL01871:Prkdc APN 16 15783087 missense probably benign 0.00
IGL01874:Prkdc APN 16 15734994 missense possibly damaging 0.89
IGL01930:Prkdc APN 16 15698887 missense probably damaging 1.00
IGL01984:Prkdc APN 16 15708779 missense probably benign
IGL02121:Prkdc APN 16 15717184 missense probably benign 0.18
IGL02152:Prkdc APN 16 15669285 missense probably benign 0.15
IGL02172:Prkdc APN 16 15809759 missense probably benign 0.10
IGL02336:Prkdc APN 16 15785978 missense possibly damaging 0.47
IGL02336:Prkdc APN 16 15785979 missense probably benign 0.01
IGL02393:Prkdc APN 16 15816758 missense probably benign 0.42
IGL02406:Prkdc APN 16 15670535 missense probably benign 0.00
IGL02500:Prkdc APN 16 15714282 critical splice donor site probably null
IGL02568:Prkdc APN 16 15726542 missense probably damaging 0.98
IGL02579:Prkdc APN 16 15670601 missense possibly damaging 0.83
IGL02652:Prkdc APN 16 15783087 missense probably benign 0.00
IGL02661:Prkdc APN 16 15769825 missense possibly damaging 0.92
IGL02685:Prkdc APN 16 15836043 missense possibly damaging 0.61
IGL02741:Prkdc APN 16 15752726 splice site probably benign
IGL02803:Prkdc APN 16 15833666 splice site probably benign
IGL02866:Prkdc APN 16 15831327 missense probably damaging 1.00
IGL02882:Prkdc APN 16 15651519 nonsense probably null
IGL02989:Prkdc APN 16 15800016 missense possibly damaging 0.67
IGL03053:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03071:Prkdc APN 16 15799984 missense probably benign 0.01
IGL03091:Prkdc APN 16 15705310 splice site probably benign
IGL03100:Prkdc APN 16 15713635 missense probably benign 0.08
IGL03128:Prkdc APN 16 15700744 splice site probably benign
IGL03168:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03204:Prkdc APN 16 15769801 missense probably benign 0.01
IGL03390:Prkdc APN 16 15670626 nonsense probably null
anhimid UTSW 16 15725461 critical splice donor site probably null
anhinga UTSW 16 15708932 critical splice donor site probably null
Bushtit UTSW 16 15752764 missense probably damaging 0.97
clover UTSW 16 15702157 splice site probably benign
crackle UTSW 16 15786050 critical splice donor site probably null
Daffy UTSW 16 15829697 missense possibly damaging 0.86
darter UTSW 16 15773613 missense possibly damaging 0.93
Elmer_fudd UTSW 16 15808058 missense probably benign 0.01
envenomation UTSW 16 15835227 nonsense probably null
hobgoblin UTSW 16 15815986 missense probably damaging 1.00
Incubus UTSW 16 15672327 missense probably damaging 1.00
liming UTSW 16 15752829 nonsense probably null
newt UTSW 16 15727726 missense probably benign 0.04
ornithorhynchus UTSW 16 15816659 critical splice donor site probably null
primitive UTSW 16 15835158 frame shift probably null
roadrunner UTSW 16 15833887 missense probably damaging 1.00
Schreier UTSW 16 15670528 missense probably benign 0.00
screamer UTSW 16 15831282 nonsense probably null
Screamer10 UTSW 16 15768025 missense probably damaging 0.98
screamer2 UTSW 16 15652552 critical splice donor site probably null
screamer3 UTSW 16 15740332 critical splice donor site probably null
screamer4 UTSW 16 15783079 missense probably benign 0.00
screamer5 UTSW 16 15687404 missense probably benign
screamer6 UTSW 16 15759605 missense probably damaging 1.00
screamer7 UTSW 16 15654817 splice site probably null
Screamer8 UTSW 16 15719433 missense probably benign 0.00
Screamer9 UTSW 16 15734922 missense probably benign 0.01
Tweetie UTSW 16 15717801 missense probably damaging 1.00
updock UTSW 16 15795094 missense probably benign
ANU23:Prkdc UTSW 16 15667731 missense possibly damaging 0.67
R0008:Prkdc UTSW 16 15708701 splice site probably benign
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0069:Prkdc UTSW 16 15726504 missense probably benign 0.03
R0125:Prkdc UTSW 16 15699007 missense probably damaging 0.98
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0132:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0137:Prkdc UTSW 16 15740332 critical splice donor site probably null
R0334:Prkdc UTSW 16 15736799 missense probably benign 0.00
R0373:Prkdc UTSW 16 15791927 missense probably damaging 1.00
R0485:Prkdc UTSW 16 15833740 missense probably damaging 0.97
R0511:Prkdc UTSW 16 15831282 nonsense probably null
R0538:Prkdc UTSW 16 15833788 missense probably damaging 1.00
R0595:Prkdc UTSW 16 15808088 missense probably damaging 1.00
R0607:Prkdc UTSW 16 15772057 missense probably damaging 0.98
R0616:Prkdc UTSW 16 15690407 missense probably damaging 1.00
R0630:Prkdc UTSW 16 15810801 missense probably damaging 1.00
R0694:Prkdc UTSW 16 15768637 missense probably damaging 1.00
R0702:Prkdc UTSW 16 15785971 missense possibly damaging 0.95
R0965:Prkdc UTSW 16 15829716 missense probably benign
R1027:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R1029:Prkdc UTSW 16 15654749 splice site probably benign
R1033:Prkdc UTSW 16 15767951 missense probably damaging 1.00
R1067:Prkdc UTSW 16 15752782 missense probably damaging 0.99
R1116:Prkdc UTSW 16 15783079 missense probably benign 0.00
R1187:Prkdc UTSW 16 15759746 missense probably damaging 0.98
R1226:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R1279:Prkdc UTSW 16 15690282 missense probably damaging 1.00
R1304:Prkdc UTSW 16 15759723 missense probably damaging 0.99
R1314:Prkdc UTSW 16 15664227 missense possibly damaging 0.68
R1351:Prkdc UTSW 16 15667700 missense possibly damaging 0.62
R1509:Prkdc UTSW 16 15731566 missense probably damaging 1.00
R1512:Prkdc UTSW 16 15687404 missense probably benign
R1531:Prkdc UTSW 16 15772106 missense probably benign 0.01
R1579:Prkdc UTSW 16 15675328 missense probably benign 0.00
R1669:Prkdc UTSW 16 15734058 missense probably damaging 1.00
R1682:Prkdc UTSW 16 15676989 missense probably benign 0.19
R1713:Prkdc UTSW 16 15795094 missense probably benign
R1762:Prkdc UTSW 16 15637961 missense probably benign
R1789:Prkdc UTSW 16 15739524 missense probably damaging 1.00
R1822:Prkdc UTSW 16 15759605 missense probably damaging 1.00
R1848:Prkdc UTSW 16 15808058 missense probably benign 0.01
R1887:Prkdc UTSW 16 15829635 missense probably benign 0.00
R1891:Prkdc UTSW 16 15725436 missense probably benign 0.02
R1921:Prkdc UTSW 16 15714215 missense possibly damaging 0.80
R1922:Prkdc UTSW 16 15714266 missense probably benign 0.00
R1929:Prkdc UTSW 16 15654817 splice site probably null
R1939:Prkdc UTSW 16 15835913 missense possibly damaging 0.95
R2021:Prkdc UTSW 16 15677009 missense probably benign 0.00
R2033:Prkdc UTSW 16 15687352 splice site probably benign
R2056:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2057:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2058:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2082:Prkdc UTSW 16 15715963 missense probably damaging 1.00
R2109:Prkdc UTSW 16 15687390 missense probably benign 0.01
R2124:Prkdc UTSW 16 15719433 missense probably benign 0.00
R2174:Prkdc UTSW 16 15734922 missense probably benign 0.01
R2191:Prkdc UTSW 16 15698824 missense probably damaging 1.00
R2270:Prkdc UTSW 16 15654817 splice site probably null
R2271:Prkdc UTSW 16 15654817 splice site probably null
R2272:Prkdc UTSW 16 15654817 splice site probably null
R2356:Prkdc UTSW 16 15684204 missense probably benign
R2852:Prkdc UTSW 16 15652552 critical splice donor site probably null
R3115:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3116:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3499:Prkdc UTSW 16 15768025 missense probably damaging 0.98
R3687:Prkdc UTSW 16 15799967 missense probably benign
R3834:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3835:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3961:Prkdc UTSW 16 15829611 splice site probably null
R4151:Prkdc UTSW 16 15816773 missense probably benign
R4233:Prkdc UTSW 16 15835919 missense probably benign 0.11
R4281:Prkdc UTSW 16 15806099 splice site probably null
R4296:Prkdc UTSW 16 15737905 missense probably damaging 0.99
R4344:Prkdc UTSW 16 15768022 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15773739 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R4497:Prkdc UTSW 16 15700653 missense probably benign 0.43
R4549:Prkdc UTSW 16 15736870 missense possibly damaging 0.89
R4594:Prkdc UTSW 16 15767966 missense possibly damaging 0.64
R4603:Prkdc UTSW 16 15810824 missense probably damaging 0.98
R4615:Prkdc UTSW 16 15663074 missense probably damaging 0.99
R4648:Prkdc UTSW 16 15816774 missense probably benign 0.05
R4662:Prkdc UTSW 16 15734052 missense probably damaging 1.00
R4680:Prkdc UTSW 16 15772030 missense probably benign 0.00
R4700:Prkdc UTSW 16 15702112 missense probably damaging 1.00
R4716:Prkdc UTSW 16 15810837 missense probably benign 0.32
R4720:Prkdc UTSW 16 15667715 missense probably benign
R4785:Prkdc UTSW 16 15648976 missense probably benign 0.21
R4822:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R4829:Prkdc UTSW 16 15702075 missense possibly damaging 0.80
R4981:Prkdc UTSW 16 15678309 missense probably damaging 1.00
R4989:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R5059:Prkdc UTSW 16 15838018 missense probably damaging 1.00
R5074:Prkdc UTSW 16 15772048 missense probably damaging 1.00
R5115:Prkdc UTSW 16 15790580 missense probably benign
R5151:Prkdc UTSW 16 15716035 missense probably damaging 1.00
R5165:Prkdc UTSW 16 15678272 missense probably damaging 1.00
R5215:Prkdc UTSW 16 15772121 missense possibly damaging 0.64
R5270:Prkdc UTSW 16 15734955 missense probably damaging 1.00
R5278:Prkdc UTSW 16 15714974 missense probably damaging 1.00
R5351:Prkdc UTSW 16 15831312 missense probably benign 0.03
R5416:Prkdc UTSW 16 15805950 missense probably damaging 1.00
R5418:Prkdc UTSW 16 15795097 missense probably benign 0.20
R5437:Prkdc UTSW 16 15769875 missense possibly damaging 0.46
R5452:Prkdc UTSW 16 15768637 missense possibly damaging 0.96
R5518:Prkdc UTSW 16 15678308 missense probably damaging 1.00
R5538:Prkdc UTSW 16 15651469 missense probably damaging 1.00
R5589:Prkdc UTSW 16 15706791 missense probably benign 0.02
R5618:Prkdc UTSW 16 15809612 missense probably damaging 1.00
R5640:Prkdc UTSW 16 15829769 missense possibly damaging 0.86
R5661:Prkdc UTSW 16 15810770 missense possibly damaging 0.81
R5771:Prkdc UTSW 16 15664233 missense probably damaging 1.00
R5772:Prkdc UTSW 16 15779388 missense possibly damaging 0.49
R5783:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R5792:Prkdc UTSW 16 15816752 missense probably damaging 1.00
R5797:Prkdc UTSW 16 15737834 nonsense probably null
R5826:Prkdc UTSW 16 15734098 missense probably benign
R5883:Prkdc UTSW 16 15715914 missense probably benign
R5895:Prkdc UTSW 16 15752829 nonsense probably null
R5998:Prkdc UTSW 16 15783157 missense probably damaging 1.00
R6000:Prkdc UTSW 16 15829697 missense possibly damaging 0.86
R6120:Prkdc UTSW 16 15739471 missense probably benign 0.00
R6145:Prkdc UTSW 16 15772073 missense probably damaging 1.00
R6209:Prkdc UTSW 16 15790592 missense probably damaging 1.00
R6293:Prkdc UTSW 16 15787155 missense probably benign 0.00
R6321:Prkdc UTSW 16 15714919 missense probably benign
R6376:Prkdc UTSW 16 15769885 missense probably benign 0.06
R6387:Prkdc UTSW 16 15698815 missense probably benign 0.01
R6406:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R6469:Prkdc UTSW 16 15795075 missense probably benign 0.10
R6486:Prkdc UTSW 16 15752764 missense probably damaging 0.97
R6665:Prkdc UTSW 16 15786050 critical splice donor site probably null
R6703:Prkdc UTSW 16 15670528 missense probably benign 0.00
R6774:Prkdc UTSW 16 15725461 critical splice donor site probably null
R6854:Prkdc UTSW 16 15651538 missense probably damaging 1.00
R6878:Prkdc UTSW 16 15777072 missense probably benign 0.31
R6882:Prkdc UTSW 16 15783263 critical splice donor site probably null
R6882:Prkdc UTSW 16 15808156 missense probably benign 0.33
R6949:Prkdc UTSW 16 15799989 missense probably benign
R6950:Prkdc UTSW 16 15815986 missense probably damaging 1.00
R7019:Prkdc UTSW 16 15769966 missense probably benign 0.00
R7064:Prkdc UTSW 16 15790453 missense probably benign 0.00
R7097:Prkdc UTSW 16 15689343 missense probably damaging 1.00
R7201:Prkdc UTSW 16 15698803 missense probably benign 0.12
R7235:Prkdc UTSW 16 15714263 missense probably benign
R7283:Prkdc UTSW 16 15717764 missense probably benign 0.00
R7401:Prkdc UTSW 16 15648738 missense probably damaging 1.00
R7525:Prkdc UTSW 16 15672327 missense probably damaging 1.00
R7647:Prkdc UTSW 16 15737943 missense probably damaging 1.00
R7679:Prkdc UTSW 16 15831319 missense probably damaging 1.00
R7803:Prkdc UTSW 16 15806096 missense probably null 0.05
R7858:Prkdc UTSW 16 15689277 missense probably benign 0.11
R7872:Prkdc UTSW 16 15715006 missense probably benign 0.05
R7896:Prkdc UTSW 16 15708903 missense probably damaging 0.97
R8032:Prkdc UTSW 16 15779451 missense probably benign 0.00
R8055:Prkdc UTSW 16 15816885 missense probably benign 0.09
R8153:Prkdc UTSW 16 15664244 missense probably damaging 1.00
R8281:Prkdc UTSW 16 15705253 missense probably damaging 1.00
R8302:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R8322:Prkdc UTSW 16 15714141 splice site probably benign
R8401:Prkdc UTSW 16 15773613 missense possibly damaging 0.93
R8440:Prkdc UTSW 16 15835158 frame shift probably null
R8458:Prkdc UTSW 16 15790676 critical splice donor site probably null
R8472:Prkdc UTSW 16 15651536 missense probably damaging 1.00
R8478:Prkdc UTSW 16 15648924 missense probably benign 0.00
R8515:Prkdc UTSW 16 15664368 missense probably damaging 1.00
R8546:Prkdc UTSW 16 15663035 missense probably damaging 1.00
R8678:Prkdc UTSW 16 15708932 critical splice donor site probably null
R8739:Prkdc UTSW 16 15808204 missense probably benign 0.01
R8749:Prkdc UTSW 16 15783165 missense possibly damaging 0.85
R8836:Prkdc UTSW 16 15727659 missense probably damaging 1.00
R8904:Prkdc UTSW 16 15727726 missense probably benign 0.04
R8952:Prkdc UTSW 16 15673760 intron probably benign
R8971:Prkdc UTSW 16 15675365 missense probably null 0.99
R8974:Prkdc UTSW 16 15799862 splice site probably null
R9052:Prkdc UTSW 16 15690296 missense probably benign 0.05
R9069:Prkdc UTSW 16 15835227 nonsense probably null
R9200:Prkdc UTSW 16 15705289 missense probably damaging 1.00
R9235:Prkdc UTSW 16 15833887 missense probably damaging 1.00
R9278:Prkdc UTSW 16 15816659 critical splice donor site probably null
R9309:Prkdc UTSW 16 15708928 nonsense probably null
R9386:Prkdc UTSW 16 15678272 missense probably damaging 0.99
R9452:Prkdc UTSW 16 15667601 missense possibly damaging 0.90
R9500:Prkdc UTSW 16 15839215 missense possibly damaging 0.76
R9608:Prkdc UTSW 16 15730470 missense possibly damaging 0.96
R9608:Prkdc UTSW 16 15730471 missense probably damaging 1.00
R9636:Prkdc UTSW 16 15730477 missense probably benign 0.19
R9656:Prkdc UTSW 16 15799954 missense probably benign 0.00
R9674:Prkdc UTSW 16 15715955 missense probably damaging 0.98
R9760:Prkdc UTSW 16 15839180 nonsense probably null
X0023:Prkdc UTSW 16 15740278 missense probably benign
Z1176:Prkdc UTSW 16 15687422 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-01