Incidental Mutation 'R2164:Scube3'
ID 235387
Institutional Source Beutler Lab
Gene Symbol Scube3
Ensembl Gene ENSMUSG00000038677
Gene Name signal peptide, CUB domain, EGF-like 3
Synonyms
MMRRC Submission 040167-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R2164 (G1)
Quality Score 212
Status Not validated
Chromosome 17
Chromosomal Location 28142316-28174852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28166134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 686 (V686D)
Ref Sequence ENSEMBL: ENSMUSP00000038366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043503]
AlphaFold Q66PY1
Predicted Effect possibly damaging
Transcript: ENSMUST00000043503
AA Change: V686D

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038366
Gene: ENSMUSG00000038677
AA Change: V686D

DomainStartEndE-ValueType
low complexity region 9 15 N/A INTRINSIC
EGF_CA 29 69 5.23e-9 SMART
EGF_CA 70 111 1.2e-8 SMART
EGF_CA 112 152 1.14e-9 SMART
EGF 160 198 6.65e-2 SMART
EGF 200 237 7.95e0 SMART
EGF 239 276 7.76e-3 SMART
EGF_CA 277 317 7.63e-11 SMART
EGF_CA 318 356 7.01e-10 SMART
EGF_CA 357 398 6.8e-8 SMART
Pfam:GCC2_GCC3 642 689 8.6e-15 PFAM
Pfam:GCC2_GCC3 696 743 4.2e-17 PFAM
Pfam:GCC2_GCC3 752 799 5.8e-17 PFAM
CUB 804 916 1.09e-16 SMART
Blast:CUB 942 988 8e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132670
SMART Domains Protein: ENSMUSP00000117490
Gene: ENSMUSG00000038677

DomainStartEndE-ValueType
EGF_like 1 28 1.2e-1 SMART
EGF_CA 29 69 1.14e-9 SMART
EGF 77 115 6.65e-2 SMART
EGF 117 154 7.95e0 SMART
EGF 156 193 7.76e-3 SMART
EGF_CA 194 234 7.63e-11 SMART
EGF_CA 235 273 7.01e-10 SMART
EGF_CA 274 315 6.8e-8 SMART
Pfam:GCC2_GCC3 559 606 1.8e-17 PFAM
Pfam:GCC2_GCC3 615 662 4.2e-17 PFAM
CUB 667 779 1.09e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148342
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted allele encoding a truncated protein exhibit normal morphology. Mice with a point mutation show skeletal abnormalities, bone metabolism alterations, changes in renal function, behavioral alternations and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Scube3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Scube3 APN 17 28167684 missense probably damaging 1.00
IGL02189:Scube3 APN 17 28162996 missense probably benign
IGL02416:Scube3 APN 17 28164136 missense probably damaging 1.00
IGL02904:Scube3 APN 17 28167600 missense probably benign 0.01
IGL03153:Scube3 APN 17 28167058 missense possibly damaging 0.54
IGL03309:Scube3 APN 17 28164357 nonsense probably null
dinklage UTSW 17 28162388 missense probably damaging 1.00
R0027:Scube3 UTSW 17 28164357 nonsense probably null
R0084:Scube3 UTSW 17 28162961 missense probably benign 0.12
R0122:Scube3 UTSW 17 28166528 splice site probably benign
R0544:Scube3 UTSW 17 28164153 missense probably damaging 1.00
R1779:Scube3 UTSW 17 28168379 splice site probably benign
R1842:Scube3 UTSW 17 28165089 missense probably damaging 1.00
R1878:Scube3 UTSW 17 28152413 missense probably benign 0.10
R1950:Scube3 UTSW 17 28164300 missense possibly damaging 0.66
R2011:Scube3 UTSW 17 28168158 missense probably damaging 0.99
R4356:Scube3 UTSW 17 28164309 missense probably benign 0.01
R4392:Scube3 UTSW 17 28164788 missense probably null
R4528:Scube3 UTSW 17 28162999 missense possibly damaging 0.82
R4709:Scube3 UTSW 17 28167192 splice site probably null
R4809:Scube3 UTSW 17 28165173 missense probably damaging 1.00
R4832:Scube3 UTSW 17 28166015 missense probably damaging 0.98
R4841:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R4842:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R5372:Scube3 UTSW 17 28152482 missense probably damaging 0.99
R5889:Scube3 UTSW 17 28160913 missense possibly damaging 0.84
R5936:Scube3 UTSW 17 28165487 missense probably damaging 1.00
R6523:Scube3 UTSW 17 28162388 missense probably damaging 1.00
R7051:Scube3 UTSW 17 28167599 missense probably benign
R7337:Scube3 UTSW 17 28168182 missense probably damaging 1.00
R7699:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7700:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7848:Scube3 UTSW 17 28165595 missense probably benign
R7950:Scube3 UTSW 17 28171226 missense probably benign 0.11
R8991:Scube3 UTSW 17 28164053 missense probably damaging 0.98
R9376:Scube3 UTSW 17 28164696 missense possibly damaging 0.92
R9469:Scube3 UTSW 17 28167164 nonsense probably null
R9653:Scube3 UTSW 17 28156798 missense probably damaging 1.00
R9660:Scube3 UTSW 17 28152440 missense probably benign 0.05
RF009:Scube3 UTSW 17 28168397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGATCTCCCATGGCTGGAG -3'
(R):5'- GTCACCCAGTCTTAGGGAAC -3'

Sequencing Primer
(F):5'- AAGGGGAGTCTTAGGCCTG -3'
(R):5'- CCAGTCTTAGGGAACAGCGG -3'
Posted On 2014-10-01