Incidental Mutation 'R2164:Dync2li1'
ID 235389
Institutional Source Beutler Lab
Gene Symbol Dync2li1
Ensembl Gene ENSMUSG00000024253
Gene Name dynein cytoplasmic 2 light intermediate chain 1
Synonyms mD2LIC, 4933404O11Rik, LIC3, D2lic, CGI-60
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 84626496-84655558 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84636274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 92 (S92P)
Ref Sequence ENSEMBL: ENSMUSP00000025101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025101]
AlphaFold Q8K0T2
Predicted Effect probably damaging
Transcript: ENSMUST00000025101
AA Change: S92P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025101
Gene: ENSMUSG00000024253
AA Change: S92P

DomainStartEndE-ValueType
Pfam:DLIC 2 179 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the dynein-2 microtubule motor protein complex that plays a role in the retrograde transport of cargo in primary cilia via the intraflagellar transport system. This gene is ubiquitously expressed and its protein, which localizes to the axoneme and Golgi apparatus, interacts directly with the cytoplasmic dynein 2 heavy chain 1 protein to form part of the multi-protein dynein-2 complex. Mutations in this gene produce defects in the dynein-2 complex which result in several types of ciliopathy including short-rib thoracic dysplasia 15 with polydactyly (SRTD15). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for disruptions in this allele die before embryonic day 11.5. They display neural tube defects in addition to a variety developmental patterning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Dync2li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dync2li1 APN 17 84644726 missense possibly damaging 0.86
IGL00661:Dync2li1 APN 17 84649240 missense possibly damaging 0.88
IGL01450:Dync2li1 APN 17 84633556 missense possibly damaging 0.53
IGL01610:Dync2li1 APN 17 84628314 missense probably damaging 1.00
R0387:Dync2li1 UTSW 17 84655340 missense possibly damaging 0.69
R0883:Dync2li1 UTSW 17 84649271 missense probably benign 0.01
R1499:Dync2li1 UTSW 17 84647239 splice site probably benign
R1823:Dync2li1 UTSW 17 84649797 missense probably damaging 0.98
R2394:Dync2li1 UTSW 17 84644747 missense possibly damaging 0.94
R2443:Dync2li1 UTSW 17 84647665 missense probably benign 0.30
R3901:Dync2li1 UTSW 17 84631642 missense probably damaging 1.00
R4151:Dync2li1 UTSW 17 84628335 missense probably benign 0.00
R4934:Dync2li1 UTSW 17 84649255 missense probably benign
R4960:Dync2li1 UTSW 17 84633541 missense probably benign 0.07
R5340:Dync2li1 UTSW 17 84649702 splice site probably null
R5841:Dync2li1 UTSW 17 84633562 missense probably damaging 1.00
R6230:Dync2li1 UTSW 17 84647650 missense probably damaging 0.97
R7331:Dync2li1 UTSW 17 84647658 nonsense probably null
R7447:Dync2li1 UTSW 17 84647713 missense possibly damaging 0.77
R8492:Dync2li1 UTSW 17 84649706 splice site probably null
R8827:Dync2li1 UTSW 17 84647651 missense possibly damaging 0.83
R9228:Dync2li1 UTSW 17 84649709 missense probably benign 0.00
R9231:Dync2li1 UTSW 17 84628391 missense probably null 0.19
Predicted Primers PCR Primer
(F):5'- ACAGCTCCTTTGTTCTGTAGAATG -3'
(R):5'- ACACTTTTCCCGCTAGCAGG -3'

Sequencing Primer
(F):5'- CTCCTTTGTTCTGTAGAATGCATTTG -3'
(R):5'- TCCCGCTAGCAGGCTTGTAAAG -3'
Posted On 2014-10-01