Incidental Mutation 'R2165:Or5ak4'
ID 235398
Institutional Source Beutler Lab
Gene Symbol Or5ak4
Ensembl Gene ENSMUSG00000075223
Gene Name olfactory receptor family 5 subfamily AK member 4
Synonyms Olfr987, MOR203-7P, GA_x6K02T2Q125-46808500-46807571
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85161311-85162240 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85161446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 265 (N265K)
Ref Sequence ENSEMBL: ENSMUSP00000150619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099929] [ENSMUST00000111598] [ENSMUST00000216347]
AlphaFold Q7TRA2
Predicted Effect probably benign
Transcript: ENSMUST00000099929
AA Change: N265K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097513
Gene: ENSMUSG00000075223
AA Change: N265K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 254 5.9e-6 PFAM
Pfam:7tm_1 41 290 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111598
AA Change: N265K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107225
Gene: ENSMUSG00000075223
AA Change: N265K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 254 5.9e-6 PFAM
Pfam:7tm_1 41 290 1.7e-31 PFAM
Pfam:7tm_4 139 283 6.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216347
AA Change: N265K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Or5ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Or5ak4 APN 2 85,161,945 (GRCm39) missense probably benign 0.37
IGL02267:Or5ak4 APN 2 85,161,465 (GRCm39) missense probably damaging 1.00
IGL03167:Or5ak4 APN 2 85,161,664 (GRCm39) missense probably benign 0.01
IGL03195:Or5ak4 APN 2 85,161,864 (GRCm39) missense probably damaging 1.00
R0918:Or5ak4 UTSW 2 85,162,276 (GRCm39) intron probably benign
R1573:Or5ak4 UTSW 2 85,161,687 (GRCm39) missense probably damaging 1.00
R1956:Or5ak4 UTSW 2 85,161,444 (GRCm39) missense probably benign 0.00
R4086:Or5ak4 UTSW 2 85,162,170 (GRCm39) missense probably benign 0.35
R5386:Or5ak4 UTSW 2 85,161,979 (GRCm39) missense probably benign 0.00
R5652:Or5ak4 UTSW 2 85,161,717 (GRCm39) missense probably damaging 1.00
R6753:Or5ak4 UTSW 2 85,162,142 (GRCm39) missense probably benign
R6755:Or5ak4 UTSW 2 85,162,142 (GRCm39) missense probably benign
R8347:Or5ak4 UTSW 2 85,162,047 (GRCm39) missense probably damaging 0.99
R9158:Or5ak4 UTSW 2 85,161,348 (GRCm39) missense probably benign 0.00
R9470:Or5ak4 UTSW 2 85,161,673 (GRCm39) missense probably damaging 1.00
Z1176:Or5ak4 UTSW 2 85,162,237 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCCATTCAATATGTGCCTTG -3'
(R):5'- AACCTGTTGAGTACTGTGCTGG -3'

Sequencing Primer
(F):5'- CTGGGGTTCAGAAATAGCTTGC -3'
(R):5'- AGTACTGTGCTGGTTGTCATC -3'
Posted On 2014-10-01