Incidental Mutation 'R2165:Bub1'
ID235402
Institutional Source Beutler Lab
Gene Symbol Bub1
Ensembl Gene ENSMUSG00000027379
Gene NameBUB1, mitotic checkpoint serine/threonine kinase
SynonymsD2Xrf87, Bub1a
MMRRC Submission 040168-MU
Accession Numbers

Genbank: NM_009772; MGI: 1100510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2165 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127801122-127831865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127801281 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1048 (I1048V)
Ref Sequence ENSEMBL: ENSMUSP00000028858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028858]
Predicted Effect probably benign
Transcript: ENSMUST00000028858
AA Change: I1048V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028858
Gene: ENSMUSG00000027379
AA Change: I1048V

DomainStartEndE-ValueType
Mad3_BUB1_I 4 126 7.41e-46 SMART
low complexity region 216 225 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Pfam:Pkinase_Tyr 762 1011 9.3e-10 PFAM
Pfam:Pkinase 762 1037 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138624
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality prior to implantation. Mice homozygous for a kinase dead allele exhibit aneuploidy in somatic and germ cells and reduced male fertility. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(3) Targeted, other(4) Gene trapped(15)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,112,399 T806A possibly damaging Het
Adgre1 T G 17: 57,419,338 L403R probably damaging Het
AF067061 A T 13: 120,264,097 Q99L probably damaging Het
Alox12 A T 11: 70,242,572 probably null Het
Ankib1 A T 5: 3,713,210 D506E possibly damaging Het
Ascc3 T G 10: 50,721,839 Y1268D probably damaging Het
Bik A G 15: 83,541,423 M42V probably benign Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Cad A G 5: 31,062,220 N621S probably damaging Het
Camkv C A 9: 107,945,600 N69K possibly damaging Het
Ccdc110 T C 8: 45,942,839 M589T probably benign Het
Ccdc154 T A 17: 25,170,890 V498E probably damaging Het
Ccr1l1 A G 9: 123,977,654 L252P probably damaging Het
Cdh1 T C 8: 106,664,321 C690R probably damaging Het
Cfap157 T G 2: 32,778,163 probably null Het
Cux2 A G 5: 121,887,477 S43P possibly damaging Het
Cyb5rl C T 4: 107,068,683 P21S probably damaging Het
Cyp51 T G 5: 4,086,594 Q400P probably damaging Het
Dnah7b T C 1: 46,097,992 probably benign Het
Ephb4 A G 5: 137,354,426 I90M probably benign Het
Fam13c A G 10: 70,542,693 N269S probably damaging Het
Fam83c T A 2: 155,831,524 Y248F possibly damaging Het
Fat2 A G 11: 55,303,716 F1166L probably benign Het
Fem1a A G 17: 56,257,686 N260D probably benign Het
Fnbp4 T A 2: 90,767,399 probably null Het
Fut9 T A 4: 25,619,733 *360Y probably null Het
Fut9 T A 4: 25,619,734 *360L probably null Het
Gm11639 G A 11: 104,751,862 V1104I possibly damaging Het
Gm3727 T A 14: 7,264,625 Q10L probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Haspin A C 11: 73,136,630 N544K probably damaging Het
Havcr1 A G 11: 46,778,552 N286S probably benign Het
Lrp6 A C 6: 134,459,283 C1307G probably damaging Het
Lrrc2 A C 9: 110,979,577 H294P possibly damaging Het
Mon2 A C 10: 123,042,364 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprb1 T C 7: 48,447,322 I281V probably benign Het
Muc4 A G 16: 32,750,476 E118G probably damaging Het
Nefh T C 11: 4,943,872 D394G probably damaging Het
Neurl4 A G 11: 69,903,221 T168A probably benign Het
Olfr347 T A 2: 36,734,701 C127S probably damaging Het
Olfr642 T C 7: 104,049,638 T239A probably benign Het
Olfr982 A G 9: 40,074,915 N207D possibly damaging Het
Olfr987 A T 2: 85,331,102 N265K probably benign Het
Oxsr1 A C 9: 119,294,432 M92R probably damaging Het
Pde8a T C 7: 81,295,768 probably null Het
Pex5l T A 3: 32,953,132 probably null Het
Pik3r4 T A 9: 105,672,785 M1025K probably benign Het
Plch1 C T 3: 63,698,482 E1325K probably benign Het
Plin2 A T 4: 86,668,432 V54E probably damaging Het
Pqlc3 G A 12: 16,989,839 L192F probably damaging Het
Prss47 A T 13: 65,045,073 I298N probably damaging Het
Prune2 A G 19: 17,120,182 R1017G probably benign Het
Psg19 T A 7: 18,796,986 Y81F possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rrnad1 A T 3: 87,927,053 probably null Het
Serpinb1a T C 13: 32,850,414 probably benign Het
Sh3pxd2a A T 19: 47,278,355 V265E probably damaging Het
Slc22a17 A T 14: 54,908,825 Y337* probably null Het
Slc25a27 A G 17: 43,657,772 V138A probably benign Het
Slc4a2 A G 5: 24,431,316 Y220C probably damaging Het
Stab1 A T 14: 31,168,435 S20T probably benign Het
Thsd1 G T 8: 22,238,522 probably benign Het
Tmem204 G A 17: 25,080,592 probably benign Het
Tom1l1 A G 11: 90,649,895 probably benign Het
Toporsl T A 4: 52,612,072 F655Y possibly damaging Het
Vmn2r98 A G 17: 19,081,291 K852E unknown Het
Wdpcp T G 11: 21,691,884 L174R probably damaging Het
Zbbx G A 3: 75,112,107 P99S probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp600 A T 4: 146,196,918 R719* probably null Het
Zfp697 C A 3: 98,428,014 A365E unknown Het
Zfp957 A C 14: 79,213,613 S249A probably benign Het
Other mutations in Bub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Bub1 APN 2 127829472 missense probably damaging 0.96
IGL00795:Bub1 APN 2 127821815 missense probably benign 0.00
IGL00966:Bub1 APN 2 127810663 missense probably damaging 1.00
IGL01807:Bub1 APN 2 127812977 missense probably benign 0.00
IGL02212:Bub1 APN 2 127805351 missense probably damaging 1.00
IGL02537:Bub1 APN 2 127801347 nonsense probably null
IGL02935:Bub1 APN 2 127801295 missense probably damaging 1.00
IGL03064:Bub1 APN 2 127817453 missense probably benign 0.00
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0325:Bub1 UTSW 2 127801394 nonsense probably null
R1502:Bub1 UTSW 2 127827419 missense probably damaging 0.98
R1627:Bub1 UTSW 2 127809013 missense probably benign 0.01
R1743:Bub1 UTSW 2 127813850 missense probably damaging 1.00
R1778:Bub1 UTSW 2 127803122 missense possibly damaging 0.60
R2043:Bub1 UTSW 2 127804220 missense probably damaging 1.00
R2108:Bub1 UTSW 2 127819335 missense probably damaging 0.99
R2190:Bub1 UTSW 2 127810725 missense probably benign 0.06
R2507:Bub1 UTSW 2 127801423 missense probably benign 0.04
R2508:Bub1 UTSW 2 127801423 missense probably benign 0.04
R3836:Bub1 UTSW 2 127814886 missense probably damaging 1.00
R3862:Bub1 UTSW 2 127814756 splice site probably benign
R3904:Bub1 UTSW 2 127821942 missense probably benign 0.08
R4373:Bub1 UTSW 2 127805236 intron probably benign
R4580:Bub1 UTSW 2 127829676 critical splice donor site probably null
R4751:Bub1 UTSW 2 127823938 intron probably benign
R5239:Bub1 UTSW 2 127821696 missense probably damaging 1.00
R5498:Bub1 UTSW 2 127814709 missense possibly damaging 0.59
R5591:Bub1 UTSW 2 127819343 missense probably benign 0.16
R5672:Bub1 UTSW 2 127804880 missense possibly damaging 0.70
R5907:Bub1 UTSW 2 127819222 missense probably benign 0.02
R6714:Bub1 UTSW 2 127814732 missense probably benign 0.08
R6781:Bub1 UTSW 2 127807857 missense probably damaging 0.99
R6931:Bub1 UTSW 2 127801382 missense probably damaging 1.00
R7057:Bub1 UTSW 2 127829527 missense probably benign
R7094:Bub1 UTSW 2 127821761 missense probably null 0.99
Z1176:Bub1 UTSW 2 127829565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTAGAACAACTAGGTCACATGGG -3'
(R):5'- ACTCGTTGCTATGAACGTTAAGG -3'

Sequencing Primer
(F):5'- TCACATGGGTATATCATATGGGC -3'
(R):5'- GAACGTTAAGGTTGCATTTTATCC -3'
Posted On2014-10-01