Incidental Mutation 'R2165:Plch1'
ID 235405
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Name phospholipase C, eta 1
Synonyms Plcl3, PLCeta1
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 63603655-63806893 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63605903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1325 (E1325K)
Ref Sequence ENSEMBL: ENSMUSP00000135424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000177143] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947]
AlphaFold Q4KWH5
Predicted Effect probably benign
Transcript: ENSMUST00000048134
AA Change: E1295K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: E1295K

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059973
AA Change: E1333K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: E1333K

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084105
AA Change: E1334K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: E1334K

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159374
Predicted Effect probably benign
Transcript: ENSMUST00000159676
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159982
Predicted Effect probably benign
Transcript: ENSMUST00000177143
AA Change: E1325K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: E1325K

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160638
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162269
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176861
Predicted Effect probably benign
Transcript: ENSMUST00000175947
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63,639,150 (GRCm39) splice site probably null
IGL01542:Plch1 APN 3 63,639,070 (GRCm39) missense probably damaging 0.99
IGL01999:Plch1 APN 3 63,660,728 (GRCm39) missense probably damaging 1.00
IGL02153:Plch1 APN 3 63,688,772 (GRCm39) missense probably damaging 1.00
IGL02203:Plch1 APN 3 63,606,160 (GRCm39) missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63,606,382 (GRCm39) missense probably damaging 0.97
IGL02259:Plch1 APN 3 63,630,170 (GRCm39) critical splice donor site probably null
IGL02268:Plch1 APN 3 63,606,704 (GRCm39) makesense probably null
IGL02411:Plch1 APN 3 63,605,177 (GRCm39) splice site probably null
IGL02472:Plch1 APN 3 63,609,270 (GRCm39) missense probably damaging 1.00
IGL02477:Plch1 APN 3 63,660,714 (GRCm39) missense probably damaging 1.00
IGL02503:Plch1 APN 3 63,605,285 (GRCm39) missense probably damaging 1.00
IGL02800:Plch1 APN 3 63,605,899 (GRCm39) missense probably benign 0.21
IGL03167:Plch1 APN 3 63,630,165 (GRCm39) splice site probably benign
IGL03182:Plch1 APN 3 63,610,015 (GRCm39) nonsense probably null
IGL03197:Plch1 APN 3 63,660,591 (GRCm39) missense probably damaging 1.00
IGL03251:Plch1 APN 3 63,691,423 (GRCm39) missense possibly damaging 0.93
BB009:Plch1 UTSW 3 63,609,402 (GRCm39) missense probably benign 0.05
BB019:Plch1 UTSW 3 63,609,402 (GRCm39) missense probably benign 0.05
R0335:Plch1 UTSW 3 63,618,399 (GRCm39) missense probably damaging 1.00
R0347:Plch1 UTSW 3 63,660,737 (GRCm39) missense probably damaging 1.00
R0631:Plch1 UTSW 3 63,606,640 (GRCm39) missense probably benign 0.23
R0687:Plch1 UTSW 3 63,623,450 (GRCm39) missense probably damaging 1.00
R0738:Plch1 UTSW 3 63,609,974 (GRCm39) intron probably benign
R0883:Plch1 UTSW 3 63,660,677 (GRCm39) missense probably damaging 1.00
R1437:Plch1 UTSW 3 63,604,954 (GRCm39) missense probably benign 0.37
R1678:Plch1 UTSW 3 63,648,115 (GRCm39) missense probably damaging 1.00
R1738:Plch1 UTSW 3 63,626,659 (GRCm39) missense probably benign 0.12
R1929:Plch1 UTSW 3 63,651,956 (GRCm39) missense probably damaging 1.00
R1955:Plch1 UTSW 3 63,662,688 (GRCm39) missense probably damaging 0.98
R2078:Plch1 UTSW 3 63,609,364 (GRCm39) missense probably benign 0.01
R2112:Plch1 UTSW 3 63,630,227 (GRCm39) missense probably damaging 1.00
R2158:Plch1 UTSW 3 63,628,655 (GRCm39) missense probably benign 0.00
R2259:Plch1 UTSW 3 63,605,398 (GRCm39) missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63,651,956 (GRCm39) missense probably damaging 1.00
R3110:Plch1 UTSW 3 63,616,952 (GRCm39) missense probably damaging 1.00
R3112:Plch1 UTSW 3 63,616,952 (GRCm39) missense probably damaging 1.00
R3407:Plch1 UTSW 3 63,606,768 (GRCm39) unclassified probably benign
R3408:Plch1 UTSW 3 63,606,768 (GRCm39) unclassified probably benign
R3791:Plch1 UTSW 3 63,606,944 (GRCm39) missense probably benign
R3793:Plch1 UTSW 3 63,605,252 (GRCm39) missense probably damaging 0.96
R3928:Plch1 UTSW 3 63,675,044 (GRCm39) missense probably damaging 1.00
R4211:Plch1 UTSW 3 63,618,640 (GRCm39) missense probably damaging 1.00
R4212:Plch1 UTSW 3 63,778,180 (GRCm39) start gained probably benign
R4223:Plch1 UTSW 3 63,609,321 (GRCm39) missense probably damaging 1.00
R4491:Plch1 UTSW 3 63,648,160 (GRCm39) missense probably damaging 1.00
R4589:Plch1 UTSW 3 63,688,928 (GRCm39) missense probably damaging 1.00
R4656:Plch1 UTSW 3 63,611,598 (GRCm39) missense probably damaging 1.00
R4701:Plch1 UTSW 3 63,606,917 (GRCm39) splice site probably null
R4716:Plch1 UTSW 3 63,688,967 (GRCm39) missense probably damaging 1.00
R4772:Plch1 UTSW 3 63,660,746 (GRCm39) missense probably damaging 1.00
R4902:Plch1 UTSW 3 63,648,264 (GRCm39) intron probably benign
R5058:Plch1 UTSW 3 63,630,202 (GRCm39) missense probably damaging 1.00
R5092:Plch1 UTSW 3 63,606,131 (GRCm39) missense probably benign 0.02
R5093:Plch1 UTSW 3 63,681,136 (GRCm39) missense probably damaging 0.99
R5210:Plch1 UTSW 3 63,607,199 (GRCm39) critical splice donor site probably null
R5368:Plch1 UTSW 3 63,609,394 (GRCm39) missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63,605,499 (GRCm39) missense probably benign 0.01
R5374:Plch1 UTSW 3 63,605,499 (GRCm39) missense probably benign 0.01
R5501:Plch1 UTSW 3 63,615,162 (GRCm39) missense probably damaging 1.00
R5606:Plch1 UTSW 3 63,648,108 (GRCm39) missense probably benign 0.35
R5738:Plch1 UTSW 3 63,681,076 (GRCm39) missense probably damaging 1.00
R5835:Plch1 UTSW 3 63,604,943 (GRCm39) missense probably benign
R6106:Plch1 UTSW 3 63,609,444 (GRCm39) missense probably damaging 1.00
R6107:Plch1 UTSW 3 63,609,444 (GRCm39) missense probably damaging 1.00
R6108:Plch1 UTSW 3 63,609,444 (GRCm39) missense probably damaging 1.00
R6110:Plch1 UTSW 3 63,606,279 (GRCm39) missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63,609,444 (GRCm39) missense probably damaging 1.00
R6147:Plch1 UTSW 3 63,630,302 (GRCm39) missense probably damaging 1.00
R6195:Plch1 UTSW 3 63,648,210 (GRCm39) missense probably damaging 1.00
R6315:Plch1 UTSW 3 63,688,811 (GRCm39) nonsense probably null
R6316:Plch1 UTSW 3 63,688,811 (GRCm39) nonsense probably null
R6317:Plch1 UTSW 3 63,688,811 (GRCm39) nonsense probably null
R6318:Plch1 UTSW 3 63,688,811 (GRCm39) nonsense probably null
R6324:Plch1 UTSW 3 63,688,811 (GRCm39) nonsense probably null
R6325:Plch1 UTSW 3 63,688,811 (GRCm39) nonsense probably null
R6326:Plch1 UTSW 3 63,688,811 (GRCm39) nonsense probably null
R6479:Plch1 UTSW 3 63,651,931 (GRCm39) missense probably benign 0.06
R6544:Plch1 UTSW 3 63,758,399 (GRCm39) missense probably damaging 1.00
R6767:Plch1 UTSW 3 63,662,765 (GRCm39) missense probably damaging 1.00
R6829:Plch1 UTSW 3 63,604,939 (GRCm39) missense probably damaging 0.99
R6891:Plch1 UTSW 3 63,605,504 (GRCm39) missense probably benign
R6893:Plch1 UTSW 3 63,660,562 (GRCm39) nonsense probably null
R6921:Plch1 UTSW 3 63,615,155 (GRCm39) missense possibly damaging 0.90
R7298:Plch1 UTSW 3 63,623,458 (GRCm39) nonsense probably null
R7396:Plch1 UTSW 3 63,606,375 (GRCm39) missense probably benign 0.00
R7420:Plch1 UTSW 3 63,630,278 (GRCm39) missense probably damaging 1.00
R7566:Plch1 UTSW 3 63,688,663 (GRCm39) splice site probably null
R7572:Plch1 UTSW 3 63,648,105 (GRCm39) missense possibly damaging 0.89
R7649:Plch1 UTSW 3 63,605,590 (GRCm39) nonsense probably null
R7696:Plch1 UTSW 3 63,662,726 (GRCm39) missense probably benign
R7851:Plch1 UTSW 3 63,605,855 (GRCm39) missense probably damaging 0.99
R7853:Plch1 UTSW 3 63,681,068 (GRCm39) missense probably benign 0.44
R7932:Plch1 UTSW 3 63,609,402 (GRCm39) missense probably benign 0.05
R7983:Plch1 UTSW 3 63,615,164 (GRCm39) missense probably damaging 1.00
R8057:Plch1 UTSW 3 63,605,557 (GRCm39) missense probably benign
R8066:Plch1 UTSW 3 63,618,478 (GRCm39) nonsense probably null
R8206:Plch1 UTSW 3 63,610,047 (GRCm39) splice site probably null
R8678:Plch1 UTSW 3 63,623,468 (GRCm39) nonsense probably null
R8731:Plch1 UTSW 3 63,605,059 (GRCm39) missense probably benign 0.37
R8739:Plch1 UTSW 3 63,778,106 (GRCm39) missense possibly damaging 0.66
R8853:Plch1 UTSW 3 63,688,967 (GRCm39) missense probably damaging 1.00
R8875:Plch1 UTSW 3 63,618,391 (GRCm39) missense probably damaging 1.00
R8945:Plch1 UTSW 3 63,639,039 (GRCm39) missense probably benign 0.02
R8947:Plch1 UTSW 3 63,691,547 (GRCm39) missense probably damaging 0.99
R8953:Plch1 UTSW 3 63,639,126 (GRCm39) missense possibly damaging 0.94
R9065:Plch1 UTSW 3 63,674,924 (GRCm39) missense probably damaging 1.00
R9068:Plch1 UTSW 3 63,612,036 (GRCm39) missense probably damaging 1.00
R9188:Plch1 UTSW 3 63,639,075 (GRCm39) missense probably null 1.00
R9238:Plch1 UTSW 3 63,606,412 (GRCm39) missense possibly damaging 0.53
R9478:Plch1 UTSW 3 63,606,825 (GRCm39) missense probably benign 0.01
R9526:Plch1 UTSW 3 63,758,549 (GRCm39) intron probably benign
R9539:Plch1 UTSW 3 63,691,427 (GRCm39) missense probably null 0.01
R9634:Plch1 UTSW 3 63,605,152 (GRCm39) missense probably damaging 1.00
R9643:Plch1 UTSW 3 63,660,747 (GRCm39) missense
R9659:Plch1 UTSW 3 63,681,136 (GRCm39) missense probably benign 0.17
R9711:Plch1 UTSW 3 63,615,176 (GRCm39) missense probably damaging 1.00
R9788:Plch1 UTSW 3 63,681,136 (GRCm39) missense probably benign 0.17
R9799:Plch1 UTSW 3 63,605,591 (GRCm39) missense possibly damaging 0.89
RF018:Plch1 UTSW 3 63,628,636 (GRCm39) missense probably damaging 1.00
X0028:Plch1 UTSW 3 63,651,930 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCTCAAGCCCCTCTGAATG -3'
(R):5'- ACGCAGTTCCTTGTGGAGTG -3'

Sequencing Primer
(F):5'- AAGCCCCTCTGAATGTGTTC -3'
(R):5'- GGAGTGATTGGTTCTCCCATCTC -3'
Posted On 2014-10-01