Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Fut9'

235412

Institutional Source

Beutler Lab

Gene Symbol

Fut9

Ensembl Gene

ENSMUSG00000055373

Gene Name

fucosyltransferase 9

Synonyms

mFuc-TIX, mFUT9

MMRRC Submission

040168-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25609332-25800244 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to A at 25619734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Leucine at position 360 (*360L)

Ref Sequence

ENSEMBL: ENSMUSP00000103834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]

AlphaFold

O88819

Predicted Effect

probably null
Transcript: ENSMUST00000084770
AA Change: *360L

SMART Domains

Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: *360L

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_10	6	358	2.9e-140	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108199
AA Change: *360L

SMART Domains

Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: *360L

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Glyco_tran_10_N	61	169	1.4e-43	PFAM
Pfam:Glyco_transf_10	185	357	4.8e-69	PFAM

Meta Mutation Damage Score

0.8518

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Fut9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00919:Fut9	APN	4	25620316	missense	possibly damaging	0.71
IGL01134:Fut9	APN	4	25620446	missense	probably benign	0.13
IGL01330:Fut9	APN	4	25619791	missense	possibly damaging	0.95
IGL01732:Fut9	APN	4	25619867	missense	possibly damaging	0.58
IGL02824:Fut9	APN	4	25620037	missense	probably damaging	1.00
ANU74:Fut9	UTSW	4	25620802	missense	probably benign	0.25
R0280:Fut9	UTSW	4	25619852	missense	probably benign	0.00
R0408:Fut9	UTSW	4	25620319	missense	possibly damaging	0.69
R0594:Fut9	UTSW	4	25620526	missense	possibly damaging	0.94
R0609:Fut9	UTSW	4	25620811	start codon destroyed	probably null	0.98
R0709:Fut9	UTSW	4	25620359	missense	probably damaging	1.00
R1567:Fut9	UTSW	4	25620344	missense	probably damaging	0.99
R1719:Fut9	UTSW	4	25619744	missense	possibly damaging	0.62
R1856:Fut9	UTSW	4	25620352	missense	probably damaging	1.00
R2036:Fut9	UTSW	4	25620322	missense	probably damaging	1.00
R2165:Fut9	UTSW	4	25619733	makesense	probably null
R2332:Fut9	UTSW	4	25619823	nonsense	probably null
R4539:Fut9	UTSW	4	25619793	missense	probably damaging	1.00
R4722:Fut9	UTSW	4	25799734	utr 5 prime	probably benign
R4766:Fut9	UTSW	4	25799191	intron	probably benign
R4937:Fut9	UTSW	4	25799591	splice site	probably benign
R5025:Fut9	UTSW	4	25620502	missense	probably damaging	1.00
R5032:Fut9	UTSW	4	25799245	intron	probably benign
R5158:Fut9	UTSW	4	25620731	missense	probably benign	0.01
R5601:Fut9	UTSW	4	25620299	missense	probably benign	0.00
R5974:Fut9	UTSW	4	25620090	nonsense	probably null
R6315:Fut9	UTSW	4	25619774	missense	probably damaging	1.00
R6385:Fut9	UTSW	4	25620328	missense	probably damaging	1.00
R6652:Fut9	UTSW	4	25620619	missense	probably benign	0.44
R6809:Fut9	UTSW	4	25620647	missense	probably benign
R6825:Fut9	UTSW	4	25619925	missense	probably benign
R7145:Fut9	UTSW	4	25620507	missense	probably damaging	0.96
R7573:Fut9	UTSW	4	25620691	missense	probably benign	0.04
R8933:Fut9	UTSW	4	25619861	missense	probably damaging	1.00
R9715:Fut9	UTSW	4	25620679	missense	probably benign	0.00
X0057:Fut9	UTSW	4	25799686	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAGTGCTCGTTATCACATATATACAG -3'
(R):5'- CCCAGTGAGTTAGCAAAATATCTG -3'

Sequencing Primer
(F):5'- TACATGGTCCTCAAGGGA -3'
(R):5'- TAGCAAAATATCTGAAGGAAGTTGAC -3'

Posted On

2014-10-01