Incidental Mutation 'R2165:Fut9'
ID 235412
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFuc-TIX, mFUT9
MMRRC Submission 040168-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 25609332-25800244 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to A at 25619734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Leucine at position 360 (*360L)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably null
Transcript: ENSMUST00000084770
AA Change: *360L
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: *360L

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108199
AA Change: *360L
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: *360L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Meta Mutation Damage Score 0.8518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,112,399 T806A possibly damaging Het
Adgre1 T G 17: 57,419,338 L403R probably damaging Het
AF067061 A T 13: 120,264,097 Q99L probably damaging Het
Alox12 A T 11: 70,242,572 probably null Het
Ankib1 A T 5: 3,713,210 D506E possibly damaging Het
Ascc3 T G 10: 50,721,839 Y1268D probably damaging Het
Bik A G 15: 83,541,423 M42V probably benign Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Bub1 T C 2: 127,801,281 I1048V probably benign Het
Cad A G 5: 31,062,220 N621S probably damaging Het
Camkv C A 9: 107,945,600 N69K possibly damaging Het
Ccdc110 T C 8: 45,942,839 M589T probably benign Het
Ccdc154 T A 17: 25,170,890 V498E probably damaging Het
Ccr1l1 A G 9: 123,977,654 L252P probably damaging Het
Cdh1 T C 8: 106,664,321 C690R probably damaging Het
Cfap157 T G 2: 32,778,163 probably null Het
Cux2 A G 5: 121,887,477 S43P possibly damaging Het
Cyb5rl C T 4: 107,068,683 P21S probably damaging Het
Cyp51 T G 5: 4,086,594 Q400P probably damaging Het
Dnah7b T C 1: 46,097,992 probably benign Het
Ephb4 A G 5: 137,354,426 I90M probably benign Het
Fam13c A G 10: 70,542,693 N269S probably damaging Het
Fam83c T A 2: 155,831,524 Y248F possibly damaging Het
Fat2 A G 11: 55,303,716 F1166L probably benign Het
Fem1a A G 17: 56,257,686 N260D probably benign Het
Fnbp4 T A 2: 90,767,399 probably null Het
Gm11639 G A 11: 104,751,862 V1104I possibly damaging Het
Gm3727 T A 14: 7,264,625 Q10L probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Haspin A C 11: 73,136,630 N544K probably damaging Het
Havcr1 A G 11: 46,778,552 N286S probably benign Het
Lrp6 A C 6: 134,459,283 C1307G probably damaging Het
Lrrc2 A C 9: 110,979,577 H294P possibly damaging Het
Mon2 A C 10: 123,042,364 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprb1 T C 7: 48,447,322 I281V probably benign Het
Muc4 A G 16: 32,750,476 E118G probably damaging Het
Nefh T C 11: 4,943,872 D394G probably damaging Het
Neurl4 A G 11: 69,903,221 T168A probably benign Het
Olfr347 T A 2: 36,734,701 C127S probably damaging Het
Olfr642 T C 7: 104,049,638 T239A probably benign Het
Olfr982 A G 9: 40,074,915 N207D possibly damaging Het
Olfr987 A T 2: 85,331,102 N265K probably benign Het
Oxsr1 A C 9: 119,294,432 M92R probably damaging Het
Pde8a T C 7: 81,295,768 probably null Het
Pex5l T A 3: 32,953,132 probably null Het
Pik3r4 T A 9: 105,672,785 M1025K probably benign Het
Plch1 C T 3: 63,698,482 E1325K probably benign Het
Plin2 A T 4: 86,668,432 V54E probably damaging Het
Pqlc3 G A 12: 16,989,839 L192F probably damaging Het
Prss47 A T 13: 65,045,073 I298N probably damaging Het
Prune2 A G 19: 17,120,182 R1017G probably benign Het
Psg19 T A 7: 18,796,986 Y81F possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rrnad1 A T 3: 87,927,053 probably null Het
Serpinb1a T C 13: 32,850,414 probably benign Het
Sh3pxd2a A T 19: 47,278,355 V265E probably damaging Het
Slc22a17 A T 14: 54,908,825 Y337* probably null Het
Slc25a27 A G 17: 43,657,772 V138A probably benign Het
Slc4a2 A G 5: 24,431,316 Y220C probably damaging Het
Stab1 A T 14: 31,168,435 S20T probably benign Het
Thsd1 G T 8: 22,238,522 probably benign Het
Tmem204 G A 17: 25,080,592 probably benign Het
Tom1l1 A G 11: 90,649,895 probably benign Het
Toporsl T A 4: 52,612,072 F655Y possibly damaging Het
Vmn2r98 A G 17: 19,081,291 K852E unknown Het
Wdpcp T G 11: 21,691,884 L174R probably damaging Het
Zbbx G A 3: 75,112,107 P99S probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp600 A T 4: 146,196,918 R719* probably null Het
Zfp697 C A 3: 98,428,014 A365E unknown Het
Zfp957 A C 14: 79,213,613 S249A probably benign Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25620316 missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25620446 missense probably benign 0.13
IGL01330:Fut9 APN 4 25619791 missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25619867 missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25620037 missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25620802 missense probably benign 0.25
R0280:Fut9 UTSW 4 25619852 missense probably benign 0.00
R0408:Fut9 UTSW 4 25620319 missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25620526 missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25620811 start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25620359 missense probably damaging 1.00
R1567:Fut9 UTSW 4 25620344 missense probably damaging 0.99
R1719:Fut9 UTSW 4 25619744 missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25620352 missense probably damaging 1.00
R2036:Fut9 UTSW 4 25620322 missense probably damaging 1.00
R2165:Fut9 UTSW 4 25619733 makesense probably null
R2332:Fut9 UTSW 4 25619823 nonsense probably null
R4539:Fut9 UTSW 4 25619793 missense probably damaging 1.00
R4722:Fut9 UTSW 4 25799734 utr 5 prime probably benign
R4766:Fut9 UTSW 4 25799191 intron probably benign
R4937:Fut9 UTSW 4 25799591 splice site probably benign
R5025:Fut9 UTSW 4 25620502 missense probably damaging 1.00
R5032:Fut9 UTSW 4 25799245 intron probably benign
R5158:Fut9 UTSW 4 25620731 missense probably benign 0.01
R5601:Fut9 UTSW 4 25620299 missense probably benign 0.00
R5974:Fut9 UTSW 4 25620090 nonsense probably null
R6315:Fut9 UTSW 4 25619774 missense probably damaging 1.00
R6385:Fut9 UTSW 4 25620328 missense probably damaging 1.00
R6652:Fut9 UTSW 4 25620619 missense probably benign 0.44
R6809:Fut9 UTSW 4 25620647 missense probably benign
R6825:Fut9 UTSW 4 25619925 missense probably benign
R7145:Fut9 UTSW 4 25620507 missense probably damaging 0.96
R7573:Fut9 UTSW 4 25620691 missense probably benign 0.04
R8933:Fut9 UTSW 4 25619861 missense probably damaging 1.00
R9715:Fut9 UTSW 4 25620679 missense probably benign 0.00
X0057:Fut9 UTSW 4 25799686 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTGCTCGTTATCACATATATACAG -3'
(R):5'- CCCAGTGAGTTAGCAAAATATCTG -3'

Sequencing Primer
(F):5'- TACATGGTCCTCAAGGGA -3'
(R):5'- TAGCAAAATATCTGAAGGAAGTTGAC -3'
Posted On 2014-10-01