Incidental Mutation 'R2165:Fut9'
ID 235412
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFUT9, mFuc-TIX
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 25609333-25800003 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to A at 25619734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Leucine at position 360 (*360L)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably null
Transcript: ENSMUST00000084770
AA Change: *360L
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: *360L

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108199
AA Change: *360L
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: *360L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Meta Mutation Damage Score 0.8518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25,620,316 (GRCm39) missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25,620,446 (GRCm39) missense probably benign 0.13
IGL01330:Fut9 APN 4 25,619,791 (GRCm39) missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25,619,867 (GRCm39) missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25,620,037 (GRCm39) missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25,620,802 (GRCm39) missense probably benign 0.25
R0280:Fut9 UTSW 4 25,619,852 (GRCm39) missense probably benign 0.00
R0408:Fut9 UTSW 4 25,620,319 (GRCm39) missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25,620,526 (GRCm39) missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25,620,811 (GRCm39) start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25,620,359 (GRCm39) missense probably damaging 1.00
R1567:Fut9 UTSW 4 25,620,344 (GRCm39) missense probably damaging 0.99
R1719:Fut9 UTSW 4 25,619,744 (GRCm39) missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25,620,352 (GRCm39) missense probably damaging 1.00
R2036:Fut9 UTSW 4 25,620,322 (GRCm39) missense probably damaging 1.00
R2165:Fut9 UTSW 4 25,619,733 (GRCm39) makesense probably null
R2332:Fut9 UTSW 4 25,619,823 (GRCm39) nonsense probably null
R4539:Fut9 UTSW 4 25,619,793 (GRCm39) missense probably damaging 1.00
R4722:Fut9 UTSW 4 25,799,734 (GRCm39) utr 5 prime probably benign
R4766:Fut9 UTSW 4 25,799,191 (GRCm39) intron probably benign
R4937:Fut9 UTSW 4 25,799,591 (GRCm39) splice site probably benign
R5025:Fut9 UTSW 4 25,620,502 (GRCm39) missense probably damaging 1.00
R5032:Fut9 UTSW 4 25,799,245 (GRCm39) intron probably benign
R5158:Fut9 UTSW 4 25,620,731 (GRCm39) missense probably benign 0.01
R5601:Fut9 UTSW 4 25,620,299 (GRCm39) missense probably benign 0.00
R5974:Fut9 UTSW 4 25,620,090 (GRCm39) nonsense probably null
R6315:Fut9 UTSW 4 25,619,774 (GRCm39) missense probably damaging 1.00
R6385:Fut9 UTSW 4 25,620,328 (GRCm39) missense probably damaging 1.00
R6652:Fut9 UTSW 4 25,620,619 (GRCm39) missense probably benign 0.44
R6809:Fut9 UTSW 4 25,620,647 (GRCm39) missense probably benign
R6825:Fut9 UTSW 4 25,619,925 (GRCm39) missense probably benign
R7145:Fut9 UTSW 4 25,620,507 (GRCm39) missense probably damaging 0.96
R7573:Fut9 UTSW 4 25,620,691 (GRCm39) missense probably benign 0.04
R8933:Fut9 UTSW 4 25,619,861 (GRCm39) missense probably damaging 1.00
R9715:Fut9 UTSW 4 25,620,679 (GRCm39) missense probably benign 0.00
X0057:Fut9 UTSW 4 25,799,686 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTGCTCGTTATCACATATATACAG -3'
(R):5'- CCCAGTGAGTTAGCAAAATATCTG -3'

Sequencing Primer
(F):5'- TACATGGTCCTCAAGGGA -3'
(R):5'- TAGCAAAATATCTGAAGGAAGTTGAC -3'
Posted On 2014-10-01