Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Toporsl'

235413

Institutional Source

Beutler Lab

Gene Symbol

Toporsl

Ensembl Gene

ENSMUSG00000028314

Gene Name

topoisomerase I binding, arginine/serine-rich like

Synonyms

4930547C10Rik

MMRRC Submission

040168-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52596274-52612430 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52612072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 655 (F655Y)

Ref Sequence

ENSEMBL: ENSMUSP00000103298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029995] [ENSMUST00000107671]

AlphaFold

Q9D2F8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029995
AA Change: F655Y

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029995
Gene: ENSMUSG00000028314
AA Change: F655Y

Domain	Start	End	E-Value	Type
low complexity region	256	263	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107671
AA Change: F655Y

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103298
Gene: ENSMUSG00000028314
AA Change: F655Y

Domain	Start	End	E-Value	Type
low complexity region	256	263	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Toporsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00870:Toporsl	APN	4	52610172	missense	probably benign	0.21
IGL01611:Toporsl	APN	4	52610794	missense	probably damaging	1.00
IGL02638:Toporsl	APN	4	52611624	missense	probably benign	0.39
IGL02642:Toporsl	APN	4	52611114	missense	probably benign	0.09
IGL03410:Toporsl	APN	4	52611134	missense	probably benign	0.07
torsion	UTSW	4	52610489	missense	probably damaging	1.00
wound	UTSW	4	52612140	missense	possibly damaging	0.90
IGL03134:Toporsl	UTSW	4	52610281	missense	probably damaging	0.97
R0548:Toporsl	UTSW	4	52612140	missense	possibly damaging	0.90
R1444:Toporsl	UTSW	4	52610254	missense	probably benign	0.01
R2295:Toporsl	UTSW	4	52610176	missense	probably damaging	0.99
R3410:Toporsl	UTSW	4	52610970	missense	probably benign	0.10
R3905:Toporsl	UTSW	4	52611750	nonsense	probably null
R4719:Toporsl	UTSW	4	52611996	missense	probably benign	0.21
R4782:Toporsl	UTSW	4	52610845	missense	probably damaging	1.00
R5642:Toporsl	UTSW	4	52611515	nonsense	probably null
R5724:Toporsl	UTSW	4	52611346	missense	probably damaging	1.00
R5728:Toporsl	UTSW	4	52611469	missense	probably benign
R6433:Toporsl	UTSW	4	52611548	missense	possibly damaging	0.91
R7023:Toporsl	UTSW	4	52611211	missense	possibly damaging	0.47
R7292:Toporsl	UTSW	4	52611630	missense	probably benign	0.14
R7294:Toporsl	UTSW	4	52611903	missense	probably benign	0.03
R7408:Toporsl	UTSW	4	52612108	missense	probably benign	0.12
R7673:Toporsl	UTSW	4	52610679	missense	probably damaging	1.00
R7974:Toporsl	UTSW	4	52611645	missense	probably damaging	1.00
R8156:Toporsl	UTSW	4	52609975	start gained	probably benign
R8186:Toporsl	UTSW	4	52610489	missense	probably damaging	1.00
R8744:Toporsl	UTSW	4	52611967	missense	probably benign	0.01
R9117:Toporsl	UTSW	4	52609943	start gained	probably benign
R9451:Toporsl	UTSW	4	52611663	missense	possibly damaging	0.90
R9512:Toporsl	UTSW	4	52610382	missense	probably benign	0.28
X0065:Toporsl	UTSW	4	52610539	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGGAGGACATTGTGACAG -3'
(R):5'- CCATACTTTCAATGAGCCTTGG -3'

Sequencing Primer
(F):5'- AGGACATTGTGACAGTCTCTCATGC -3'
(R):5'- GGCTAAGTAGACTAATTTGCCTTTC -3'

Posted On

2014-10-01