Incidental Mutation 'R2165:Plin2'
ID 235414
Institutional Source Beutler Lab
Gene Symbol Plin2
Ensembl Gene ENSMUSG00000028494
Gene Name perilipin 2
Synonyms Adrp, ADPH, adipophilin, Adfp
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 86566623-86588297 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86586669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 54 (V54E)
Ref Sequence ENSEMBL: ENSMUSP00000123333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000466] [ENSMUST00000140382] [ENSMUST00000147097] [ENSMUST00000149700]
AlphaFold P43883
Predicted Effect probably damaging
Transcript: ENSMUST00000000466
AA Change: V54E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000466
Gene: ENSMUSG00000028494
AA Change: V54E

DomainStartEndE-ValueType
Pfam:Perilipin 6 393 5.3e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134094
Predicted Effect probably damaging
Transcript: ENSMUST00000140382
AA Change: V54E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123456
Gene: ENSMUSG00000028494
AA Change: V54E

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147097
SMART Domains Protein: ENSMUSP00000119063
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 157 3.1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149700
AA Change: V54E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123333
Gene: ENSMUSG00000028494
AA Change: V54E

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Meta Mutation Damage Score 0.8787 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for null mutations are resistant to diet-induced obesity and hepatic steatosis and may exhibit altered milk composition, vision abnormalities, or small sebaceous glands. Male mice homozygous for a gene trap allele are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Plin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Plin2 APN 4 86,582,683 (GRCm39) missense possibly damaging 0.88
IGL02501:Plin2 APN 4 86,582,723 (GRCm39) nonsense probably null
IGL02551:Plin2 APN 4 86,576,929 (GRCm39) missense probably benign 0.00
IGL03294:Plin2 APN 4 86,580,315 (GRCm39) missense probably damaging 0.96
R1484:Plin2 UTSW 4 86,575,481 (GRCm39) missense probably benign 0.00
R2870:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2870:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2873:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R3125:Plin2 UTSW 4 86,575,381 (GRCm39) nonsense probably null
R4948:Plin2 UTSW 4 86,580,228 (GRCm39) missense probably benign 0.00
R5189:Plin2 UTSW 4 86,575,383 (GRCm39) missense probably damaging 1.00
R5563:Plin2 UTSW 4 86,580,341 (GRCm39) missense probably benign 0.01
R6229:Plin2 UTSW 4 86,586,903 (GRCm39) missense probably benign
R6258:Plin2 UTSW 4 86,575,526 (GRCm39) missense probably damaging 0.97
R6260:Plin2 UTSW 4 86,575,526 (GRCm39) missense probably damaging 0.97
R6391:Plin2 UTSW 4 86,580,236 (GRCm39) missense probably null 0.99
R6470:Plin2 UTSW 4 86,586,607 (GRCm39) missense probably damaging 1.00
R6493:Plin2 UTSW 4 86,580,224 (GRCm39) missense possibly damaging 0.80
R6562:Plin2 UTSW 4 86,576,832 (GRCm39) missense probably benign 0.07
R6706:Plin2 UTSW 4 86,578,357 (GRCm39) missense probably benign 0.02
R7310:Plin2 UTSW 4 86,586,628 (GRCm39) missense probably benign 0.03
R8057:Plin2 UTSW 4 86,575,638 (GRCm39) missense possibly damaging 0.80
R8171:Plin2 UTSW 4 86,575,349 (GRCm39) missense probably damaging 0.99
R9003:Plin2 UTSW 4 86,580,324 (GRCm39) missense probably benign 0.08
R9041:Plin2 UTSW 4 86,578,504 (GRCm39) missense probably benign
R9789:Plin2 UTSW 4 86,576,914 (GRCm39) missense probably damaging 1.00
R9800:Plin2 UTSW 4 86,586,742 (GRCm39) missense possibly damaging 0.78
U24488:Plin2 UTSW 4 86,580,314 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGATTGTGCTTCAGGAAG -3'
(R):5'- CAGTAGTGGATCCGCAACAG -3'

Sequencing Primer
(F):5'- GAAGGCCTGGGGGATCC -3'
(R):5'- TGGATCCGCAACAGGTATG -3'
Posted On 2014-10-01