Incidental Mutation 'R2165:Cyb5rl'
ID 235415
Institutional Source Beutler Lab
Gene Symbol Cyb5rl
Ensembl Gene ENSMUSG00000028621
Gene Name cytochrome b5 reductase-like
Synonyms 2810410C14Rik
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 106924035-106945204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 106925880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 21 (P21S)
Ref Sequence ENSEMBL: ENSMUSP00000119366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000030365] [ENSMUST00000106756] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000154283] [ENSMUST00000149453] [ENSMUST00000145324] [ENSMUST00000137269]
AlphaFold B1AS42
Predicted Effect probably damaging
Transcript: ENSMUST00000030364
AA Change: P21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030365
SMART Domains Protein: ENSMUSP00000030365
Gene: ENSMUSG00000028622

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PDCD9 292 420 6.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106756
SMART Domains Protein: ENSMUSP00000102367
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:FAD_binding_6 20 117 4.7e-23 PFAM
Pfam:NAD_binding_1 127 241 3.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106758
AA Change: P21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621
AA Change: P21S

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106760
AA Change: P21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125157
Predicted Effect probably damaging
Transcript: ENSMUST00000154283
AA Change: P21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119366
Gene: ENSMUSG00000028621
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 4.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149453
AA Change: P21S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145324
AA Change: P21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122502
Gene: ENSMUSG00000028621
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 3.9e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000126207
AA Change: P14S
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621
AA Change: P14S

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125397
Predicted Effect probably benign
Transcript: ENSMUST00000137269
SMART Domains Protein: ENSMUSP00000119249
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:FAD_binding_6 13 110 7.3e-24 PFAM
Meta Mutation Damage Score 0.2518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Cyb5rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cyb5rl APN 4 106,941,493 (GRCm39) missense probably benign 0.21
IGL01350:Cyb5rl APN 4 106,941,409 (GRCm39) missense possibly damaging 0.77
IGL02418:Cyb5rl APN 4 106,928,182 (GRCm39) missense probably damaging 1.00
IGL02746:Cyb5rl APN 4 106,925,836 (GRCm39) missense probably benign 0.12
IGL03088:Cyb5rl APN 4 106,938,225 (GRCm39) nonsense probably null
IGL03279:Cyb5rl APN 4 106,941,325 (GRCm39) missense possibly damaging 0.95
R1301:Cyb5rl UTSW 4 106,938,104 (GRCm39) missense probably damaging 1.00
R1731:Cyb5rl UTSW 4 106,938,110 (GRCm39) missense probably damaging 1.00
R2091:Cyb5rl UTSW 4 106,928,203 (GRCm39) missense probably damaging 1.00
R2504:Cyb5rl UTSW 4 106,938,142 (GRCm39) missense probably benign 0.01
R4223:Cyb5rl UTSW 4 106,938,185 (GRCm39) missense probably damaging 0.97
R4851:Cyb5rl UTSW 4 106,941,510 (GRCm39) missense probably benign 0.39
R4964:Cyb5rl UTSW 4 106,926,329 (GRCm39) intron probably benign
R5797:Cyb5rl UTSW 4 106,941,404 (GRCm39) missense possibly damaging 0.69
R6575:Cyb5rl UTSW 4 106,942,550 (GRCm39) missense probably benign 0.20
R6688:Cyb5rl UTSW 4 106,931,102 (GRCm39) missense probably damaging 0.99
R6986:Cyb5rl UTSW 4 106,928,073 (GRCm39) missense probably benign 0.18
R7097:Cyb5rl UTSW 4 106,944,513 (GRCm39) missense unknown
R7139:Cyb5rl UTSW 4 106,928,208 (GRCm39) missense probably benign 0.35
R7293:Cyb5rl UTSW 4 106,938,143 (GRCm39) missense probably damaging 0.98
R7920:Cyb5rl UTSW 4 106,928,205 (GRCm39) missense possibly damaging 0.60
R8234:Cyb5rl UTSW 4 106,925,935 (GRCm39) missense probably damaging 1.00
R8333:Cyb5rl UTSW 4 106,925,875 (GRCm39) missense probably benign 0.03
R8367:Cyb5rl UTSW 4 106,928,146 (GRCm39) missense probably benign 0.00
R8546:Cyb5rl UTSW 4 106,925,923 (GRCm39) missense probably damaging 1.00
R8998:Cyb5rl UTSW 4 106,938,157 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCCATCCCTGTCCCTATAG -3'
(R):5'- CCAGATAGATATGGCCACTCTGG -3'

Sequencing Primer
(F):5'- CTGTCCCTATAGCCTGGTGG -3'
(R):5'- TGGACTCCTCACCTGGC -3'
Posted On 2014-10-01