Incidental Mutation 'R2165:Cyp51'
ID 235418
Institutional Source Beutler Lab
Gene Symbol Cyp51
Ensembl Gene ENSMUSG00000001467
Gene Name cytochrome P450, family 51
Synonyms
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 4131145-4154746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 4136594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 400 (Q400P)
Ref Sequence ENSEMBL: ENSMUSP00000001507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001507]
AlphaFold Q8K0C4
Predicted Effect probably damaging
Transcript: ENSMUST00000001507
AA Change: Q400P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001507
Gene: ENSMUSG00000001467
AA Change: Q400P

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:p450 61 496 1.9e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129448
Meta Mutation Damage Score 0.1647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit skeletal and craniofacial abnormalities and die at late midgestation due to heart failure resulting from cardiac hypoplasia, ventricle septum, epicardial and vasculogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Cyp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Cyp51 APN 5 4,133,247 (GRCm39) missense probably damaging 1.00
IGL02047:Cyp51 APN 5 4,149,244 (GRCm39) missense possibly damaging 0.86
IGL02191:Cyp51 APN 5 4,150,147 (GRCm39) missense probably benign 0.05
IGL02492:Cyp51 APN 5 4,154,304 (GRCm39) missense probably benign 0.01
IGL03209:Cyp51 APN 5 4,154,195 (GRCm39) missense probably damaging 1.00
PIT4515001:Cyp51 UTSW 5 4,149,122 (GRCm39) critical splice donor site probably null
PIT4520001:Cyp51 UTSW 5 4,151,200 (GRCm39) missense probably damaging 1.00
R0535:Cyp51 UTSW 5 4,149,202 (GRCm39) missense probably benign 0.00
R2048:Cyp51 UTSW 5 4,136,636 (GRCm39) splice site probably benign
R2851:Cyp51 UTSW 5 4,149,183 (GRCm39) missense probably damaging 1.00
R3975:Cyp51 UTSW 5 4,141,877 (GRCm39) missense probably damaging 0.97
R4799:Cyp51 UTSW 5 4,133,256 (GRCm39) missense probably damaging 1.00
R5699:Cyp51 UTSW 5 4,151,213 (GRCm39) missense probably damaging 1.00
R6163:Cyp51 UTSW 5 4,150,199 (GRCm39) missense probably damaging 1.00
R6484:Cyp51 UTSW 5 4,136,627 (GRCm39) missense probably benign 0.07
R7046:Cyp51 UTSW 5 4,150,188 (GRCm39) missense probably damaging 1.00
R7155:Cyp51 UTSW 5 4,137,846 (GRCm39) missense possibly damaging 0.90
R7877:Cyp51 UTSW 5 4,152,929 (GRCm39) missense probably damaging 1.00
R7904:Cyp51 UTSW 5 4,150,173 (GRCm39) missense probably damaging 0.99
R8094:Cyp51 UTSW 5 4,136,490 (GRCm39) missense probably benign 0.08
R8095:Cyp51 UTSW 5 4,136,490 (GRCm39) missense probably benign 0.08
R8938:Cyp51 UTSW 5 4,150,202 (GRCm39) missense probably benign 0.00
R8963:Cyp51 UTSW 5 4,136,519 (GRCm39) missense probably damaging 0.98
R9097:Cyp51 UTSW 5 4,149,172 (GRCm39) missense possibly damaging 0.78
R9173:Cyp51 UTSW 5 4,136,504 (GRCm39) missense probably benign
R9416:Cyp51 UTSW 5 4,150,198 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCCAGGGCAGTTAATGAAGG -3'
(R):5'- TGGCCCACTTGTAAATCACTAAG -3'

Sequencing Primer
(F):5'- GAGATACATTACAGAGGCAAACAAC -3'
(R):5'- GCCCACTTGTAAATCACTAAGTGAAG -3'
Posted On 2014-10-01