Incidental Mutation 'R2165:Cux2'
ID 235422
Institutional Source Beutler Lab
Gene Symbol Cux2
Ensembl Gene ENSMUSG00000042589
Gene Name cut-like homeobox 2
Synonyms 1700051K22Rik, ENSMUSG00000072641, Cutl2, Cux2, Cux-2
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 121996025-122188522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122025540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 43 (S43P)
Ref Sequence ENSEMBL: ENSMUSP00000114948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000134326] [ENSMUST00000154139] [ENSMUST00000168288]
AlphaFold P70298
Predicted Effect probably benign
Transcript: ENSMUST00000086317
AA Change: S43P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: S43P

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111752
AA Change: S43P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: S43P

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133760
Predicted Effect probably benign
Transcript: ENSMUST00000134326
AA Change: S43P

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144069
Predicted Effect possibly damaging
Transcript: ENSMUST00000154139
AA Change: S43P

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114948
Gene: ENSMUSG00000042589
AA Change: S43P

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168288
AA Change: S43P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: S43P

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Cux2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Cux2 APN 5 122,006,601 (GRCm39) missense possibly damaging 0.92
IGL00917:Cux2 APN 5 122,007,168 (GRCm39) missense probably null 0.05
IGL00979:Cux2 APN 5 122,011,777 (GRCm39) missense probably damaging 0.98
IGL01069:Cux2 APN 5 122,005,414 (GRCm39) missense possibly damaging 0.84
IGL01303:Cux2 APN 5 122,003,991 (GRCm39) missense probably benign 0.03
IGL01583:Cux2 APN 5 122,012,170 (GRCm39) missense probably damaging 0.98
IGL01762:Cux2 APN 5 122,011,208 (GRCm39) missense probably damaging 1.00
IGL02508:Cux2 APN 5 121,998,885 (GRCm39) missense possibly damaging 0.93
R0333:Cux2 UTSW 5 121,998,671 (GRCm39) missense probably benign 0.04
R0352:Cux2 UTSW 5 122,022,802 (GRCm39) splice site probably benign
R0443:Cux2 UTSW 5 122,025,500 (GRCm39) missense possibly damaging 0.66
R1853:Cux2 UTSW 5 122,007,184 (GRCm39) missense possibly damaging 0.95
R2011:Cux2 UTSW 5 121,999,389 (GRCm39) missense probably benign 0.21
R2057:Cux2 UTSW 5 122,007,567 (GRCm39) missense probably benign 0.02
R3964:Cux2 UTSW 5 122,025,539 (GRCm39) nonsense probably null
R4182:Cux2 UTSW 5 122,006,555 (GRCm39) missense probably damaging 1.00
R4579:Cux2 UTSW 5 121,998,716 (GRCm39) missense probably benign 0.01
R4655:Cux2 UTSW 5 122,023,997 (GRCm39) missense possibly damaging 0.95
R4673:Cux2 UTSW 5 122,025,539 (GRCm39) nonsense probably null
R4697:Cux2 UTSW 5 122,011,816 (GRCm39) missense probably damaging 1.00
R4927:Cux2 UTSW 5 122,015,152 (GRCm39) missense probably benign 0.13
R5348:Cux2 UTSW 5 122,004,041 (GRCm39) missense probably damaging 0.99
R6208:Cux2 UTSW 5 121,998,885 (GRCm39) missense possibly damaging 0.93
R6500:Cux2 UTSW 5 122,002,789 (GRCm39) missense probably benign 0.03
R6661:Cux2 UTSW 5 122,007,360 (GRCm39) missense probably benign 0.04
R6986:Cux2 UTSW 5 122,006,642 (GRCm39) missense possibly damaging 0.84
R7296:Cux2 UTSW 5 121,999,319 (GRCm39) missense probably benign 0.25
R7561:Cux2 UTSW 5 122,017,931 (GRCm39) missense probably benign 0.31
R7702:Cux2 UTSW 5 122,006,648 (GRCm39) missense possibly damaging 0.70
R7705:Cux2 UTSW 5 122,007,736 (GRCm39) missense probably benign 0.13
R7791:Cux2 UTSW 5 122,005,162 (GRCm39) missense probably benign 0.10
R7998:Cux2 UTSW 5 122,006,648 (GRCm39) missense possibly damaging 0.70
R8081:Cux2 UTSW 5 122,007,519 (GRCm39) missense probably benign 0.13
R8096:Cux2 UTSW 5 122,007,160 (GRCm39) missense possibly damaging 0.70
R8191:Cux2 UTSW 5 122,012,217 (GRCm39) missense probably benign 0.31
R8794:Cux2 UTSW 5 122,007,306 (GRCm39) missense probably benign 0.31
R8957:Cux2 UTSW 5 121,999,011 (GRCm39) missense probably benign 0.36
R9601:Cux2 UTSW 5 122,025,461 (GRCm39) missense possibly damaging 0.85
R9749:Cux2 UTSW 5 122,007,780 (GRCm39) missense possibly damaging 0.95
R9765:Cux2 UTSW 5 122,007,195 (GRCm39) missense probably benign 0.00
X0027:Cux2 UTSW 5 122,022,814 (GRCm39) missense probably benign 0.13
Z1176:Cux2 UTSW 5 122,023,997 (GRCm39) missense probably benign 0.02
Z1176:Cux2 UTSW 5 122,011,876 (GRCm39) nonsense probably null
Z1177:Cux2 UTSW 5 122,015,192 (GRCm39) missense probably benign 0.13
Z1177:Cux2 UTSW 5 122,011,743 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTAGGTTTGTCCCCAAC -3'
(R):5'- TGCTGGGATTAAAGGCATGCG -3'

Sequencing Primer
(F):5'- CATCCCGCAGTGGTGTCATTG -3'
(R):5'- GCCAGGCTCACACACACAG -3'
Posted On 2014-10-01