Incidental Mutation 'R2165:Ephb4'
ID 235423
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, b2b2412Clo, Myk1, Tyro11
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 137348371-137372784 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137352688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 90 (I90M)
Ref Sequence ENSEMBL: ENSMUSP00000130275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably benign
Transcript: ENSMUST00000061244
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: I90M

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111054
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: I90M

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111055
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: I90M

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144296
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: I90M

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166239
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: I90M

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137,363,877 (GRCm39) splice site probably benign
IGL00948:Ephb4 APN 5 137,364,921 (GRCm39) missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137,364,003 (GRCm39) splice site probably benign
IGL01885:Ephb4 APN 5 137,356,059 (GRCm39) missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137,359,456 (GRCm39) missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137,369,024 (GRCm39) missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137,370,332 (GRCm39) missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137,352,763 (GRCm39) nonsense probably null
IGL03080:Ephb4 APN 5 137,352,345 (GRCm39) splice site probably benign
IGL03111:Ephb4 APN 5 137,370,767 (GRCm39) missense probably benign 0.07
R0599:Ephb4 UTSW 5 137,368,117 (GRCm39) missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137,363,929 (GRCm39) missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137,364,796 (GRCm39) splice site probably benign
R1441:Ephb4 UTSW 5 137,359,509 (GRCm39) missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137,370,440 (GRCm39) missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137,358,696 (GRCm39) missense probably benign
R1831:Ephb4 UTSW 5 137,352,677 (GRCm39) missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137,361,572 (GRCm39) missense possibly damaging 0.53
R2206:Ephb4 UTSW 5 137,355,981 (GRCm39) missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137,363,962 (GRCm39) missense probably benign 0.15
R4779:Ephb4 UTSW 5 137,363,964 (GRCm39) missense probably benign 0.04
R4801:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137,361,574 (GRCm39) missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137,359,404 (GRCm39) missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137,368,114 (GRCm39) missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137,352,701 (GRCm39) missense probably benign 0.00
R5662:Ephb4 UTSW 5 137,370,457 (GRCm39) missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137,358,678 (GRCm39) missense probably benign 0.00
R6336:Ephb4 UTSW 5 137,370,347 (GRCm39) missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137,358,711 (GRCm39) missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137,364,849 (GRCm39) missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137,368,066 (GRCm39) missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137,359,536 (GRCm39) missense probably benign 0.00
R7145:Ephb4 UTSW 5 137,370,308 (GRCm39) missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137,352,687 (GRCm39) missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137,359,560 (GRCm39) missense probably benign
R7635:Ephb4 UTSW 5 137,370,365 (GRCm39) missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137,363,937 (GRCm39) missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137,370,699 (GRCm39) missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137,356,117 (GRCm39) missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137,369,067 (GRCm39) missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137,352,824 (GRCm39) missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137,361,529 (GRCm39) missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137,361,564 (GRCm39) missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137,371,820 (GRCm39) missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137,359,621 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTGCACAGAAACACTCCGAG -3'
(R):5'- TTGTAGTGGCATCGATCCCC -3'

Sequencing Primer
(F):5'- TAGCTAGACGTCCTGACTGACAG -3'
(R):5'- CCCAGACTGTTGGTACCTTGATG -3'
Posted On 2014-10-01