Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Ephb4'

235423

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

040168-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 137354426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 90 (I90M)

Ref Sequence

ENSEMBL: ENSMUSP00000130275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

AlphaFold

P54761

Predicted Effect

probably benign
Transcript: ENSMUST00000061244
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: I90M

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111054
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: I90M

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111055
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: I90M

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144296
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: I90M

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166239
AA Change: I90M

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: I90M

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1831:Ephb4	UTSW	5	137354415	missense	probably damaging	1.00
R1865:Ephb4	UTSW	5	137363310	missense	possibly damaging	0.53
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5307:Ephb4	UTSW	5	137363312	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5662:Ephb4	UTSW	5	137372195	missense	probably damaging	0.98
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R6973:Ephb4	UTSW	5	137369804	missense	probably damaging	1.00
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
R8539:Ephb4	UTSW	5	137357855	missense	probably damaging	1.00
R8904:Ephb4	UTSW	5	137370805	missense	probably damaging	1.00
R9228:Ephb4	UTSW	5	137354562	missense	possibly damaging	0.79
R9327:Ephb4	UTSW	5	137363267	missense	probably damaging	0.99
R9513:Ephb4	UTSW	5	137363302	missense	possibly damaging	0.76
R9659:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
R9788:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTTGCACAGAAACACTCCGAG -3'
(R):5'- TTGTAGTGGCATCGATCCCC -3'

Sequencing Primer
(F):5'- TAGCTAGACGTCCTGACTGACAG -3'
(R):5'- CCCAGACTGTTGGTACCTTGATG -3'

Posted On

2014-10-01