Incidental Mutation 'R2165:Lrp6'
ID 235424
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Name low density lipoprotein receptor-related protein 6
Synonyms ska, Cd, skax26, ska26
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 134423439-134543876 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 134436246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 1307 (C1307G)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032322
AA Change: C1307G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: C1307G

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111950
SMART Domains Protein: ENSMUSP00000107581
Gene: ENSMUSG00000030201

DomainStartEndE-ValueType
LY 11 53 1.41e-5 SMART
LY 59 102 5.32e-1 SMART
LY 103 147 5e-6 SMART
LY 148 190 4.25e-9 SMART
LY 191 231 1.91e-2 SMART
EGF 260 304 1.23e1 SMART
LDLa 302 341 2.42e-12 SMART
LDLa 342 378 4.37e-10 SMART
LDLa 379 416 1.66e-10 SMART
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 483 492 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 620 627 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203773
Meta Mutation Damage Score 0.9729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134,433,053 (GRCm39) missense probably benign 0.17
IGL00765:Lrp6 APN 6 134,518,817 (GRCm39) missense probably benign 0.02
IGL00898:Lrp6 APN 6 134,456,702 (GRCm39) missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134,461,252 (GRCm39) missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134,484,609 (GRCm39) missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134,488,225 (GRCm39) missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134,433,108 (GRCm39) missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134,427,900 (GRCm39) nonsense probably null
IGL02067:Lrp6 APN 6 134,457,359 (GRCm39) missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134,490,290 (GRCm39) missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134,434,697 (GRCm39) missense probably benign 0.40
IGL02484:Lrp6 APN 6 134,518,886 (GRCm39) missense probably benign 0.15
IGL02724:Lrp6 APN 6 134,461,228 (GRCm39) missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134,433,077 (GRCm39) missense probably benign 0.43
IGL03011:Lrp6 APN 6 134,497,380 (GRCm39) missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134,456,726 (GRCm39) missense probably damaging 1.00
Aileron UTSW 6 134,439,579 (GRCm39) missense probably damaging 1.00
Cielo UTSW 6 134,484,624 (GRCm39) nonsense probably null
Coiled UTSW 6 134,484,521 (GRCm39) nonsense probably null
flap UTSW 6 134,463,549 (GRCm39) missense probably damaging 0.99
soar UTSW 6 134,488,169 (GRCm39) missense probably damaging 0.97
Swoop UTSW 6 134,463,504 (GRCm39) missense possibly damaging 0.94
Upswing UTSW 6 134,441,414 (GRCm39) missense probably damaging 0.99
Wingman UTSW 6 134,434,705 (GRCm39) missense probably damaging 1.00
BB004:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
BB014:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
PIT4494001:Lrp6 UTSW 6 134,456,741 (GRCm39) missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134,462,716 (GRCm39) missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134,462,716 (GRCm39) missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134,427,860 (GRCm39) nonsense probably null
R0295:Lrp6 UTSW 6 134,434,656 (GRCm39) missense probably benign 0.02
R0370:Lrp6 UTSW 6 134,456,729 (GRCm39) missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134,444,631 (GRCm39) missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134,484,587 (GRCm39) missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134,462,624 (GRCm39) missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134,457,481 (GRCm39) missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134,433,039 (GRCm39) missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134,456,738 (GRCm39) missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134,519,008 (GRCm39) missense probably benign 0.13
R0907:Lrp6 UTSW 6 134,484,488 (GRCm39) missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134,444,470 (GRCm39) critical splice donor site probably null
R1548:Lrp6 UTSW 6 134,436,392 (GRCm39) missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134,430,529 (GRCm39) missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134,445,732 (GRCm39) missense probably benign 0.01
R1696:Lrp6 UTSW 6 134,445,686 (GRCm39) missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134,441,531 (GRCm39) missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134,441,414 (GRCm39) missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134,457,337 (GRCm39) critical splice donor site probably null
R2015:Lrp6 UTSW 6 134,457,337 (GRCm39) critical splice donor site probably null
R2294:Lrp6 UTSW 6 134,434,705 (GRCm39) missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134,484,546 (GRCm39) missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134,444,489 (GRCm39) missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134,484,410 (GRCm39) missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134,483,321 (GRCm39) nonsense probably null
R4521:Lrp6 UTSW 6 134,462,825 (GRCm39) missense probably damaging 1.00
R4573:Lrp6 UTSW 6 134,447,693 (GRCm39) nonsense probably null
R4645:Lrp6 UTSW 6 134,461,213 (GRCm39) missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134,488,230 (GRCm39) missense probably benign
R4688:Lrp6 UTSW 6 134,456,706 (GRCm39) missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134,456,502 (GRCm39) missense probably benign 0.06
R5236:Lrp6 UTSW 6 134,488,227 (GRCm39) missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134,436,259 (GRCm39) missense probably benign 0.09
R5508:Lrp6 UTSW 6 134,441,479 (GRCm39) missense probably benign 0.31
R6001:Lrp6 UTSW 6 134,441,481 (GRCm39) missense probably benign 0.03
R6319:Lrp6 UTSW 6 134,518,798 (GRCm39) missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134,457,458 (GRCm39) missense probably benign
R6552:Lrp6 UTSW 6 134,431,692 (GRCm39) missense probably benign 0.17
R6559:Lrp6 UTSW 6 134,490,217 (GRCm39) missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134,518,934 (GRCm39) missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134,484,521 (GRCm39) nonsense probably null
R6700:Lrp6 UTSW 6 134,456,523 (GRCm39) missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134,463,504 (GRCm39) missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134,484,514 (GRCm39) missense probably benign
R7266:Lrp6 UTSW 6 134,484,364 (GRCm39) missense probably damaging 1.00
R7339:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134,427,923 (GRCm39) nonsense probably null
R7366:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7368:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7501:Lrp6 UTSW 6 134,463,471 (GRCm39) missense probably damaging 1.00
R7548:Lrp6 UTSW 6 134,484,471 (GRCm39) missense probably damaging 0.97
R7652:Lrp6 UTSW 6 134,488,208 (GRCm39) nonsense probably null
R7771:Lrp6 UTSW 6 134,439,579 (GRCm39) missense probably damaging 1.00
R7927:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
R8717:Lrp6 UTSW 6 134,434,711 (GRCm39) missense probably benign 0.41
R8726:Lrp6 UTSW 6 134,484,624 (GRCm39) nonsense probably null
R8792:Lrp6 UTSW 6 134,463,549 (GRCm39) missense probably damaging 0.99
R8812:Lrp6 UTSW 6 134,433,141 (GRCm39) missense probably benign
R8855:Lrp6 UTSW 6 134,445,785 (GRCm39) missense probably benign 0.04
R8866:Lrp6 UTSW 6 134,445,785 (GRCm39) missense probably benign 0.04
R8994:Lrp6 UTSW 6 134,518,656 (GRCm39) missense probably benign
R9021:Lrp6 UTSW 6 134,518,930 (GRCm39) missense probably benign 0.00
R9089:Lrp6 UTSW 6 134,488,169 (GRCm39) missense probably damaging 0.97
R9154:Lrp6 UTSW 6 134,518,855 (GRCm39) missense probably damaging 1.00
R9263:Lrp6 UTSW 6 134,457,467 (GRCm39) missense probably damaging 1.00
R9287:Lrp6 UTSW 6 134,483,259 (GRCm39) missense probably benign 0.21
R9545:Lrp6 UTSW 6 134,483,329 (GRCm39) missense probably damaging 1.00
R9574:Lrp6 UTSW 6 134,447,662 (GRCm39) missense possibly damaging 0.90
R9640:Lrp6 UTSW 6 134,441,414 (GRCm39) missense probably damaging 0.99
Z1176:Lrp6 UTSW 6 134,433,120 (GRCm39) missense possibly damaging 0.72
Z1177:Lrp6 UTSW 6 134,439,504 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGTATTTCGATCAAGTAGC -3'
(R):5'- AACGTGTTCTCCTCAGCAG -3'

Sequencing Primer
(F):5'- GTGCAAGGCATAGTCAAATATAAAAC -3'
(R):5'- AGTTTACCTGCTTCACTGGGGAC -3'
Posted On 2014-10-01