Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Pde8a'

235427

Institutional Source

Beutler Lab

Gene Symbol

Pde8a

Ensembl Gene

ENSMUSG00000025584

Gene Name

phosphodiesterase 8A

Synonyms

Pde8

MMRRC Submission

040168-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81213596-81334533 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 81295768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000026672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026672] [ENSMUST00000026672]

AlphaFold

O88502

Predicted Effect

probably null
Transcript: ENSMUST00000026672

SMART Domains

Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
Blast:REC	79	194	2e-48	BLAST
PAS	211	277	2.18e-2	SMART
Blast:HDc	403	451	4e-11	BLAST
HDc	548	734	5.78e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000026672

SMART Domains

Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
Blast:REC	79	194	2e-48	BLAST
PAS	211	277	2.18e-2	SMART
Blast:HDc	403	451	4e-11	BLAST
HDc	548	734	5.78e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128154

Meta Mutation Damage Score

0.9504

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Pde8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Pde8a	APN	7	81306708	missense	possibly damaging	0.62
IGL00808:Pde8a	APN	7	81283014	critical splice donor site	probably null
IGL01134:Pde8a	APN	7	81319078	missense	possibly damaging	0.86
IGL01443:Pde8a	APN	7	81324181	missense	probably damaging	1.00
IGL02044:Pde8a	APN	7	81317449	critical splice donor site	probably null
IGL02269:Pde8a	APN	7	81308802	splice site	probably benign
IGL02528:Pde8a	APN	7	81293189	splice site	probably benign
IGL02738:Pde8a	APN	7	81326342	missense	probably damaging	1.00
IGL02937:Pde8a	APN	7	81295771	splice site	probably benign
IGL03072:Pde8a	APN	7	81308809	missense	probably damaging	1.00
cast_iron	UTSW	7	81282807	splice site	probably null
K7894:Pde8a	UTSW	7	81306765	missense	probably damaging	1.00
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0547:Pde8a	UTSW	7	81324130	missense	probably benign	0.00
R0552:Pde8a	UTSW	7	81317347	missense	probably benign	0.12
R1342:Pde8a	UTSW	7	81302294	critical splice donor site	probably null
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1502:Pde8a	UTSW	7	81292259	missense	probably damaging	1.00
R1568:Pde8a	UTSW	7	81292263	missense	probably damaging	1.00
R1768:Pde8a	UTSW	7	81300723	splice site	probably null
R2076:Pde8a	UTSW	7	81308945	missense	probably benign	0.11
R2385:Pde8a	UTSW	7	81282992	missense	probably benign	0.45
R2518:Pde8a	UTSW	7	81317422	missense	probably benign	0.00
R4001:Pde8a	UTSW	7	81317356	missense	probably damaging	1.00
R4114:Pde8a	UTSW	7	81282807	splice site	probably null
R4115:Pde8a	UTSW	7	81282807	splice site	probably null
R4159:Pde8a	UTSW	7	81320659	missense	probably benign	0.13
R4299:Pde8a	UTSW	7	81328035	missense	probably benign
R4544:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4545:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4561:Pde8a	UTSW	7	81308820	nonsense	probably null
R4562:Pde8a	UTSW	7	81308820	nonsense	probably null
R4563:Pde8a	UTSW	7	81308820	nonsense	probably null
R4615:Pde8a	UTSW	7	81320737	missense	probably damaging	1.00
R4808:Pde8a	UTSW	7	81282931	missense	probably benign
R5396:Pde8a	UTSW	7	81333422	missense	probably damaging	1.00
R5840:Pde8a	UTSW	7	81213965	missense	probably benign
R5892:Pde8a	UTSW	7	81295691	missense	probably damaging	0.99
R6621:Pde8a	UTSW	7	81293130	critical splice acceptor site	probably null
R7067:Pde8a	UTSW	7	81317326	missense	probably benign	0.41
R7163:Pde8a	UTSW	7	81306708	missense	possibly damaging	0.62
R7483:Pde8a	UTSW	7	81282833	missense	probably benign	0.02
R7606:Pde8a	UTSW	7	81332967	missense	probably damaging	0.98
R7876:Pde8a	UTSW	7	81324071	missense	probably damaging	1.00
R8046:Pde8a	UTSW	7	81308839	missense	possibly damaging	0.90
R8046:Pde8a	UTSW	7	81317370	missense	probably benign	0.14
R8832:Pde8a	UTSW	7	81306750	missense	probably benign	0.16
R9133:Pde8a	UTSW	7	81332871	missense	probably damaging	1.00
R9134:Pde8a	UTSW	7	81332871	missense	probably damaging	1.00
R9166:Pde8a	UTSW	7	81332871	missense	probably damaging	1.00
R9169:Pde8a	UTSW	7	81332871	missense	probably damaging	1.00
R9170:Pde8a	UTSW	7	81332871	missense	probably damaging	1.00
R9341:Pde8a	UTSW	7	81300679	missense	probably benign	0.01
R9343:Pde8a	UTSW	7	81300679	missense	probably benign	0.01
R9354:Pde8a	UTSW	7	81332871	missense	probably damaging	1.00
R9378:Pde8a	UTSW	7	81332871	missense	probably damaging	1.00
R9672:Pde8a	UTSW	7	81292266	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCAAATTGAAAGGCTTGTTTAGG -3'
(R):5'- CATTGAGATGGATTCCAGAAAGTC -3'

Sequencing Primer
(F):5'- GATTTCTTTTGTGGCATGCATCAAAG -3'
(R):5'- TGAGTCAGAGTCTCCCTGAAC -3'

Posted On

2014-10-01