Incidental Mutation 'R2165:Camkv'
ID 235434
Institutional Source Beutler Lab
Gene Symbol Camkv
Ensembl Gene ENSMUSG00000032936
Gene Name CaM kinase-like vesicle-associated
Synonyms
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107813097-107826882 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 107822799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 69 (N69K)
Ref Sequence ENSEMBL: ENSMUSP00000141444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035700] [ENSMUST00000193533] [ENSMUST00000194206] [ENSMUST00000195219]
AlphaFold Q3UHL1
Predicted Effect probably benign
Transcript: ENSMUST00000035700
AA Change: N69K

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040430
Gene: ENSMUSG00000032936
AA Change: N69K

DomainStartEndE-ValueType
S_TKc 24 286 4.21e-81 SMART
low complexity region 332 385 N/A INTRINSIC
internal_repeat_1 392 425 3.43e-15 PROSPERO
internal_repeat_1 416 449 3.43e-15 PROSPERO
low complexity region 461 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192318
Predicted Effect unknown
Transcript: ENSMUST00000193533
AA Change: T59K
Predicted Effect possibly damaging
Transcript: ENSMUST00000194206
AA Change: N69K

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141444
Gene: ENSMUSG00000032936
AA Change: N69K

DomainStartEndE-ValueType
STYKc 24 258 2.3e-8 SMART
low complexity region 304 357 N/A INTRINSIC
internal_repeat_1 364 397 2.93e-15 PROSPERO
internal_repeat_1 388 421 2.93e-15 PROSPERO
low complexity region 433 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194538
Predicted Effect probably benign
Transcript: ENSMUST00000195219
Meta Mutation Damage Score 0.2617 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Camkv
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0288:Camkv UTSW 9 107,823,555 (GRCm39) missense probably damaging 1.00
R0834:Camkv UTSW 9 107,823,045 (GRCm39) missense probably damaging 1.00
R1919:Camkv UTSW 9 107,824,287 (GRCm39) missense possibly damaging 0.89
R1996:Camkv UTSW 9 107,824,320 (GRCm39) missense probably damaging 1.00
R3943:Camkv UTSW 9 107,825,182 (GRCm39) missense possibly damaging 0.70
R4006:Camkv UTSW 9 107,823,840 (GRCm39) missense probably damaging 1.00
R4357:Camkv UTSW 9 107,825,145 (GRCm39) missense probably benign 0.27
R4406:Camkv UTSW 9 107,823,418 (GRCm39) critical splice donor site probably null
R4601:Camkv UTSW 9 107,823,295 (GRCm39) missense probably damaging 0.99
R5078:Camkv UTSW 9 107,822,572 (GRCm39) missense probably damaging 0.99
R5175:Camkv UTSW 9 107,824,581 (GRCm39) missense probably damaging 1.00
R5373:Camkv UTSW 9 107,824,088 (GRCm39) missense probably benign 0.05
R5379:Camkv UTSW 9 107,822,545 (GRCm39) missense probably damaging 0.99
R5480:Camkv UTSW 9 107,824,074 (GRCm39) missense probably damaging 1.00
R5484:Camkv UTSW 9 107,823,345 (GRCm39) missense probably damaging 1.00
R6335:Camkv UTSW 9 107,823,894 (GRCm39) critical splice donor site probably null
R6730:Camkv UTSW 9 107,825,516 (GRCm39) missense possibly damaging 0.73
R8430:Camkv UTSW 9 107,824,968 (GRCm39) missense probably damaging 0.99
R8701:Camkv UTSW 9 107,825,240 (GRCm39) missense possibly damaging 0.53
R8889:Camkv UTSW 9 107,823,333 (GRCm39) nonsense probably null
R8892:Camkv UTSW 9 107,823,333 (GRCm39) nonsense probably null
R8948:Camkv UTSW 9 107,824,296 (GRCm39) missense probably damaging 0.97
R8950:Camkv UTSW 9 107,824,296 (GRCm39) missense probably damaging 0.97
R9265:Camkv UTSW 9 107,825,262 (GRCm39) missense possibly damaging 0.53
R9631:Camkv UTSW 9 107,822,990 (GRCm39) missense probably benign 0.37
RF010:Camkv UTSW 9 107,825,059 (GRCm39) unclassified probably benign
RF039:Camkv UTSW 9 107,825,059 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGGGACAAGTCATCAAG -3'
(R):5'- AGTAGTCAGGGTTGAGTGCAC -3'

Sequencing Primer
(F):5'- AAGACGTGAGTGTTGGGC -3'
(R):5'- CCCAAGAGAAGCTCTGGTTTC -3'
Posted On 2014-10-01