Incidental Mutation 'R2165:Neurl4'
ID 235445
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Name neuralized E3 ubiquitin protein ligase 4
Synonyms 0610025P10Rik
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69792545-69804648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69794047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 168 (T168A)
Ref Sequence ENSEMBL: ENSMUSP00000135185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018714] [ENSMUST00000061837] [ENSMUST00000100969] [ENSMUST00000102580] [ENSMUST00000108617] [ENSMUST00000108621] [ENSMUST00000128046] [ENSMUST00000129234] [ENSMUST00000129475] [ENSMUST00000177476] [ENSMUST00000177138] [ENSMUST00000133203] [ENSMUST00000144431]
AlphaFold Q5NCX5
Predicted Effect probably benign
Transcript: ENSMUST00000018714
SMART Domains Protein: ENSMUSP00000018714
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
AA Change: T168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: T168A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100969
SMART Domains Protein: ENSMUSP00000098529
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 272 5.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102580
SMART Domains Protein: ENSMUSP00000099640
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 153 270 6.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108617
AA Change: T168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: T168A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108621
SMART Domains Protein: ENSMUSP00000104261
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128046
SMART Domains Protein: ENSMUSP00000137547
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
Pfam:IPP-2 1 77 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129234
SMART Domains Protein: ENSMUSP00000136835
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000177476
AA Change: T168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: T168A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177138
AA Change: T168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: T168A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175742
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144431
SMART Domains Protein: ENSMUSP00000135926
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69,795,413 (GRCm39) missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69,801,219 (GRCm39) missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69,797,925 (GRCm39) missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69,800,449 (GRCm39) missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69,796,616 (GRCm39) missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69,801,166 (GRCm39) missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69,797,161 (GRCm39) missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69,797,657 (GRCm39) missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69,799,891 (GRCm39) missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69,801,232 (GRCm39) missense probably benign 0.41
R0388:Neurl4 UTSW 11 69,802,559 (GRCm39) splice site probably benign
R0421:Neurl4 UTSW 11 69,799,360 (GRCm39) missense probably damaging 1.00
R0449:Neurl4 UTSW 11 69,796,393 (GRCm39) missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69,794,547 (GRCm39) critical splice donor site probably null
R1345:Neurl4 UTSW 11 69,794,702 (GRCm39) missense probably benign 0.21
R1536:Neurl4 UTSW 11 69,794,252 (GRCm39) nonsense probably null
R1642:Neurl4 UTSW 11 69,794,485 (GRCm39) missense probably benign 0.03
R1857:Neurl4 UTSW 11 69,796,361 (GRCm39) missense probably damaging 1.00
R1935:Neurl4 UTSW 11 69,797,959 (GRCm39) missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69,797,959 (GRCm39) missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69,794,036 (GRCm39) missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69,800,118 (GRCm39) missense probably benign
R2046:Neurl4 UTSW 11 69,799,523 (GRCm39) missense probably damaging 1.00
R2393:Neurl4 UTSW 11 69,797,900 (GRCm39) missense probably damaging 1.00
R3810:Neurl4 UTSW 11 69,794,859 (GRCm39) missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69,799,887 (GRCm39) missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69,801,894 (GRCm39) missense probably benign 0.00
R4898:Neurl4 UTSW 11 69,793,997 (GRCm39) missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69,798,134 (GRCm39) missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69,801,913 (GRCm39) missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69,797,194 (GRCm39) missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69,801,742 (GRCm39) critical splice donor site probably null
R6791:Neurl4 UTSW 11 69,799,336 (GRCm39) missense probably damaging 1.00
R7029:Neurl4 UTSW 11 69,801,562 (GRCm39) missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69,801,088 (GRCm39) missense probably damaging 1.00
R7361:Neurl4 UTSW 11 69,802,905 (GRCm39) missense probably benign 0.01
R7367:Neurl4 UTSW 11 69,799,408 (GRCm39) missense probably damaging 1.00
R7804:Neurl4 UTSW 11 69,796,700 (GRCm39) missense probably benign 0.00
R7871:Neurl4 UTSW 11 69,794,012 (GRCm39) missense probably benign
R8092:Neurl4 UTSW 11 69,801,891 (GRCm39) missense probably benign
R8121:Neurl4 UTSW 11 69,799,056 (GRCm39) splice site probably null
R8131:Neurl4 UTSW 11 69,800,067 (GRCm39) missense probably benign 0.12
R8289:Neurl4 UTSW 11 69,800,206 (GRCm39) critical splice donor site probably null
R8354:Neurl4 UTSW 11 69,800,062 (GRCm39) missense probably damaging 0.97
R8494:Neurl4 UTSW 11 69,801,871 (GRCm39) missense probably benign 0.02
R8529:Neurl4 UTSW 11 69,799,613 (GRCm39) missense probably damaging 1.00
R8850:Neurl4 UTSW 11 69,794,788 (GRCm39) unclassified probably benign
R8992:Neurl4 UTSW 11 69,798,958 (GRCm39) missense possibly damaging 0.69
R9334:Neurl4 UTSW 11 69,796,792 (GRCm39) missense probably damaging 1.00
R9509:Neurl4 UTSW 11 69,792,971 (GRCm39) nonsense probably null
R9705:Neurl4 UTSW 11 69,799,679 (GRCm39) missense probably damaging 0.97
R9707:Neurl4 UTSW 11 69,799,679 (GRCm39) missense probably damaging 0.97
R9746:Neurl4 UTSW 11 69,798,301 (GRCm39) missense probably damaging 1.00
X0025:Neurl4 UTSW 11 69,797,627 (GRCm39) missense probably damaging 1.00
Z1177:Neurl4 UTSW 11 69,794,916 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ATCCCAGTGTGTTGGACTTCC -3'
(R):5'- ACCTTCATCCACAGAGGTCC -3'

Sequencing Primer
(F):5'- TTGGACTTCCCGAGCAGTG -3'
(R):5'- TGTTCCAACAGGGCTGAATC -3'
Posted On 2014-10-01