Incidental Mutation 'R2165:Alox12'
ID 235446
Institutional Source Beutler Lab
Gene Symbol Alox12
Ensembl Gene ENSMUSG00000000320
Gene Name arachidonate 12-lipoxygenase
Synonyms 9930022G08Rik, P-12LO, Alox12p
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70132283-70146179 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 70133398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000329] [ENSMUST00000021180] [ENSMUST00000021181] [ENSMUST00000040428] [ENSMUST00000100950] [ENSMUST00000102569] [ENSMUST00000176116] [ENSMUST00000108575] [ENSMUST00000141880] [ENSMUST00000108576] [ENSMUST00000108577] [ENSMUST00000125752] [ENSMUST00000108578] [ENSMUST00000108579] [ENSMUST00000176268]
AlphaFold P39655
Predicted Effect probably null
Transcript: ENSMUST00000000329
SMART Domains Protein: ENSMUSP00000000329
Gene: ENSMUSG00000000320

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 172 650 5.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021180
SMART Domains Protein: ENSMUSP00000021180
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
Blast:SANT 38 69 1e-16 BLAST
SCOP:d1ba5__ 41 59 9e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021181
SMART Domains Protein: ENSMUSP00000021181
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040428
SMART Domains Protein: ENSMUSP00000048271
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100950
SMART Domains Protein: ENSMUSP00000098510
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 37 82 7.29e-1 SMART
low complexity region 105 128 N/A INTRINSIC
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102569
SMART Domains Protein: ENSMUSP00000099629
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138658
Predicted Effect probably benign
Transcript: ENSMUST00000176116
SMART Domains Protein: ENSMUSP00000135134
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108575
SMART Domains Protein: ENSMUSP00000104215
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141880
SMART Domains Protein: ENSMUSP00000135383
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108576
SMART Domains Protein: ENSMUSP00000104216
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108577
SMART Domains Protein: ENSMUSP00000104218
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125752
Predicted Effect probably null
Transcript: ENSMUST00000108578
SMART Domains Protein: ENSMUSP00000104219
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108579
SMART Domains Protein: ENSMUSP00000104220
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176268
SMART Domains Protein: ENSMUSP00000135088
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased basal transepidermal water loss and hypersensitivity to adenosine 5'-diphosphate-induced platelet aggregation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Adgre1 T G 17: 57,726,338 (GRCm39) L403R probably damaging Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Alox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Alox12 APN 11 70,145,375 (GRCm39) missense probably benign 0.12
IGL01629:Alox12 APN 11 70,133,660 (GRCm39) missense probably damaging 1.00
IGL02657:Alox12 APN 11 70,138,104 (GRCm39) missense probably benign
IGL02966:Alox12 APN 11 70,140,911 (GRCm39) missense probably damaging 1.00
R0243:Alox12 UTSW 11 70,133,542 (GRCm39) missense possibly damaging 0.82
R0357:Alox12 UTSW 11 70,133,362 (GRCm39) missense probably damaging 1.00
R0394:Alox12 UTSW 11 70,136,761 (GRCm39) missense probably damaging 1.00
R0422:Alox12 UTSW 11 70,145,384 (GRCm39) missense probably damaging 1.00
R0564:Alox12 UTSW 11 70,143,662 (GRCm39) missense probably damaging 0.99
R0751:Alox12 UTSW 11 70,137,776 (GRCm39) missense probably benign 0.00
R1539:Alox12 UTSW 11 70,144,069 (GRCm39) splice site probably null
R1562:Alox12 UTSW 11 70,140,991 (GRCm39) missense probably damaging 0.97
R2295:Alox12 UTSW 11 70,133,291 (GRCm39) missense probably benign 0.45
R4073:Alox12 UTSW 11 70,138,136 (GRCm39) missense probably damaging 1.00
R4558:Alox12 UTSW 11 70,143,889 (GRCm39) missense probably benign 0.03
R5081:Alox12 UTSW 11 70,146,140 (GRCm39) splice site probably null
R5198:Alox12 UTSW 11 70,145,243 (GRCm39) missense probably damaging 1.00
R5507:Alox12 UTSW 11 70,145,238 (GRCm39) missense possibly damaging 0.87
R5793:Alox12 UTSW 11 70,133,879 (GRCm39) missense probably benign 0.00
R5832:Alox12 UTSW 11 70,144,106 (GRCm39) missense probably damaging 0.98
R5975:Alox12 UTSW 11 70,133,609 (GRCm39) missense possibly damaging 0.89
R5984:Alox12 UTSW 11 70,137,881 (GRCm39) missense possibly damaging 0.83
R5988:Alox12 UTSW 11 70,142,413 (GRCm39) missense probably benign 0.05
R6030:Alox12 UTSW 11 70,145,417 (GRCm39) missense possibly damaging 0.72
R6030:Alox12 UTSW 11 70,145,417 (GRCm39) missense possibly damaging 0.72
R6248:Alox12 UTSW 11 70,143,936 (GRCm39) missense probably damaging 1.00
R6505:Alox12 UTSW 11 70,141,030 (GRCm39) missense probably damaging 1.00
R7320:Alox12 UTSW 11 70,145,298 (GRCm39) missense probably benign 0.02
R7595:Alox12 UTSW 11 70,133,230 (GRCm39) missense probably damaging 1.00
R7972:Alox12 UTSW 11 70,133,513 (GRCm39) missense probably benign 0.15
R8787:Alox12 UTSW 11 70,144,146 (GRCm39) missense probably benign 0.01
R8845:Alox12 UTSW 11 70,137,877 (GRCm39) missense probably damaging 1.00
R9051:Alox12 UTSW 11 70,138,153 (GRCm39) missense possibly damaging 0.93
R9055:Alox12 UTSW 11 70,143,903 (GRCm39) missense probably damaging 0.99
R9730:Alox12 UTSW 11 70,140,920 (GRCm39) missense probably benign 0.21
R9784:Alox12 UTSW 11 70,143,665 (GRCm39) missense possibly damaging 0.91
X0025:Alox12 UTSW 11 70,146,050 (GRCm39) missense probably damaging 0.96
Z1177:Alox12 UTSW 11 70,142,305 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTGCCTCAGATGGTGATACTG -3'
(R):5'- TGACGATGGAGACCGTGATG -3'

Sequencing Primer
(F):5'- GCCTCAGATGGTGATACTGTTCTC -3'
(R):5'- GTCGCTACCTGATGTGCAG -3'
Posted On 2014-10-01