Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Mrc2'

235450

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

040168-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 105348431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

AlphaFold

Q64449

Predicted Effect

probably benign
Transcript: ENSMUST00000021038

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100335

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105292783	start gained	probably benign
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105332266	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105348003	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105348355	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105343507	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105347306	missense	possibly damaging	0.62
R8771:Mrc2	UTSW	11	105349770	missense	probably benign
R8787:Mrc2	UTSW	11	105347639	missense	probably benign
R8925:Mrc2	UTSW	11	105325508	missense	probably benign	0.00
R8927:Mrc2	UTSW	11	105325508	missense	probably benign	0.00
R8991:Mrc2	UTSW	11	105338914	missense	probably benign
R9017:Mrc2	UTSW	11	105325885	missense	probably damaging	1.00
R9096:Mrc2	UTSW	11	105340572	missense	probably damaging	1.00
R9097:Mrc2	UTSW	11	105340572	missense	probably damaging	1.00
R9223:Mrc2	UTSW	11	105329267	missense	probably damaging	1.00
R9471:Mrc2	UTSW	11	105343733	missense	probably benign	0.03
R9531:Mrc2	UTSW	11	105349905	missense	possibly damaging	0.82
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105341376	missense	possibly damaging	0.94
Z1176:Mrc2	UTSW	11	105347360	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCATCTTGCACTTGAGCTG -3'
(R):5'- CTGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'

Posted On

2014-10-01