Incidental Mutation 'R2165:Pqlc3'
ID235451
Institutional Source Beutler Lab
Gene Symbol Pqlc3
Ensembl Gene ENSMUSG00000045679
Gene NamePQ loop repeat containing
Synonyms
MMRRC Submission 040168-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2165 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location16988648-17000408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16989839 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 192 (L192F)
Ref Sequence ENSEMBL: ENSMUSP00000054462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000054536] [ENSMUST00000156360] [ENSMUST00000222203]
Predicted Effect probably benign
Transcript: ENSMUST00000020904
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054536
AA Change: L192F

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054462
Gene: ENSMUSG00000045679
AA Change: L192F

DomainStartEndE-ValueType
CTNS 19 50 4.81e-2 SMART
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067572
SMART Domains Protein: ENSMUSP00000065014
Gene: ENSMUSG00000045679

DomainStartEndE-ValueType
CTNS 19 50 4.81e-2 SMART
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141232
Predicted Effect probably benign
Transcript: ENSMUST00000156360
SMART Domains Protein: ENSMUSP00000115895
Gene: ENSMUSG00000045679

DomainStartEndE-ValueType
CTNS 19 50 4.81e-2 SMART
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222203
Meta Mutation Damage Score 0.3922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,112,399 T806A possibly damaging Het
Adgre1 T G 17: 57,419,338 L403R probably damaging Het
AF067061 A T 13: 120,264,097 Q99L probably damaging Het
Alox12 A T 11: 70,242,572 probably null Het
Ankib1 A T 5: 3,713,210 D506E possibly damaging Het
Ascc3 T G 10: 50,721,839 Y1268D probably damaging Het
Bik A G 15: 83,541,423 M42V probably benign Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Bub1 T C 2: 127,801,281 I1048V probably benign Het
Cad A G 5: 31,062,220 N621S probably damaging Het
Camkv C A 9: 107,945,600 N69K possibly damaging Het
Ccdc110 T C 8: 45,942,839 M589T probably benign Het
Ccdc154 T A 17: 25,170,890 V498E probably damaging Het
Ccr1l1 A G 9: 123,977,654 L252P probably damaging Het
Cdh1 T C 8: 106,664,321 C690R probably damaging Het
Cfap157 T G 2: 32,778,163 probably null Het
Cux2 A G 5: 121,887,477 S43P possibly damaging Het
Cyb5rl C T 4: 107,068,683 P21S probably damaging Het
Cyp51 T G 5: 4,086,594 Q400P probably damaging Het
Dnah7b T C 1: 46,097,992 probably benign Het
Ephb4 A G 5: 137,354,426 I90M probably benign Het
Fam13c A G 10: 70,542,693 N269S probably damaging Het
Fam83c T A 2: 155,831,524 Y248F possibly damaging Het
Fat2 A G 11: 55,303,716 F1166L probably benign Het
Fem1a A G 17: 56,257,686 N260D probably benign Het
Fnbp4 T A 2: 90,767,399 probably null Het
Fut9 T A 4: 25,619,733 *360Y probably null Het
Fut9 T A 4: 25,619,734 *360L probably null Het
Gm11639 G A 11: 104,751,862 V1104I possibly damaging Het
Gm3727 T A 14: 7,264,625 Q10L probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Haspin A C 11: 73,136,630 N544K probably damaging Het
Havcr1 A G 11: 46,778,552 N286S probably benign Het
Lrp6 A C 6: 134,459,283 C1307G probably damaging Het
Lrrc2 A C 9: 110,979,577 H294P possibly damaging Het
Mon2 A C 10: 123,042,364 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprb1 T C 7: 48,447,322 I281V probably benign Het
Muc4 A G 16: 32,750,476 E118G probably damaging Het
Nefh T C 11: 4,943,872 D394G probably damaging Het
Neurl4 A G 11: 69,903,221 T168A probably benign Het
Olfr347 T A 2: 36,734,701 C127S probably damaging Het
Olfr642 T C 7: 104,049,638 T239A probably benign Het
Olfr982 A G 9: 40,074,915 N207D possibly damaging Het
Olfr987 A T 2: 85,331,102 N265K probably benign Het
Oxsr1 A C 9: 119,294,432 M92R probably damaging Het
Pde8a T C 7: 81,295,768 probably null Het
Pex5l T A 3: 32,953,132 probably null Het
Pik3r4 T A 9: 105,672,785 M1025K probably benign Het
Plch1 C T 3: 63,698,482 E1325K probably benign Het
Plin2 A T 4: 86,668,432 V54E probably damaging Het
Prss47 A T 13: 65,045,073 I298N probably damaging Het
Prune2 A G 19: 17,120,182 R1017G probably benign Het
Psg19 T A 7: 18,796,986 Y81F possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rrnad1 A T 3: 87,927,053 probably null Het
Serpinb1a T C 13: 32,850,414 probably benign Het
Sh3pxd2a A T 19: 47,278,355 V265E probably damaging Het
Slc22a17 A T 14: 54,908,825 Y337* probably null Het
Slc25a27 A G 17: 43,657,772 V138A probably benign Het
Slc4a2 A G 5: 24,431,316 Y220C probably damaging Het
Stab1 A T 14: 31,168,435 S20T probably benign Het
Thsd1 G T 8: 22,238,522 probably benign Het
Tmem204 G A 17: 25,080,592 probably benign Het
Tom1l1 A G 11: 90,649,895 probably benign Het
Toporsl T A 4: 52,612,072 F655Y possibly damaging Het
Vmn2r98 A G 17: 19,081,291 K852E unknown Het
Wdpcp T G 11: 21,691,884 L174R probably damaging Het
Zbbx G A 3: 75,112,107 P99S probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp600 A T 4: 146,196,918 R719* probably null Het
Zfp697 C A 3: 98,428,014 A365E unknown Het
Zfp957 A C 14: 79,213,613 S249A probably benign Het
Other mutations in Pqlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0415:Pqlc3 UTSW 12 16997710 splice site probably benign
R5405:Pqlc3 UTSW 12 16993314 intron probably benign
R5569:Pqlc3 UTSW 12 16995628 missense possibly damaging 0.93
R6271:Pqlc3 UTSW 12 16997703 missense probably damaging 1.00
R6378:Pqlc3 UTSW 12 16997643 missense probably damaging 1.00
R6854:Pqlc3 UTSW 12 16999829 missense probably damaging 1.00
X0066:Pqlc3 UTSW 12 16995625 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACAACCTAGGGGACTG -3'
(R):5'- TGTCTGGAGTCAGGGTGAAAC -3'

Sequencing Primer
(F):5'- CCCGTATTCAGCTAAGTGGC -3'
(R):5'- GAACTCACTCTGTAGACCAGGTTG -3'
Posted On2014-10-01