Incidental Mutation 'R2165:Bik'
ID 235460
Institutional Source Beutler Lab
Gene Symbol Bik
Ensembl Gene ENSMUSG00000016758
Gene Name BCL2-interacting killer
Synonyms Nbk, Biklk, Blk
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 83526862-83544634 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83541423 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 42 (M42V)
Ref Sequence ENSEMBL: ENSMUSP00000155083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000229165] [ENSMUST00000229964] [ENSMUST00000230912]
AlphaFold O70337
Predicted Effect probably benign
Transcript: ENSMUST00000016902
AA Change: M42V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758
AA Change: M42V

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229165
AA Change: M42V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229232
Predicted Effect probably benign
Transcript: ENSMUST00000229964
Predicted Effect probably benign
Transcript: ENSMUST00000230912
AA Change: M42V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a critical BH3 domain with other death-promoting proteins, such as BID, BAK, BAD and BAX, that is required for its pro-apoptotic activity, and for interaction with anti-apoptotic members of the BCL2 family, and viral survival-promoting proteins. Since the activity of this protein is suppressed in the presence of survival-promoting proteins, it is suggested as a likely target for anti-apoptotic proteins. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and grossly normal with no detectable changes in hematopoiesis, lymphocyte susceptibility to various apoptotic stimuli, or endothelial cell apoptosis in hyaloid vessel regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,112,399 T806A possibly damaging Het
Adgre1 T G 17: 57,419,338 L403R probably damaging Het
AF067061 A T 13: 120,264,097 Q99L probably damaging Het
Alox12 A T 11: 70,242,572 probably null Het
Ankib1 A T 5: 3,713,210 D506E possibly damaging Het
Ascc3 T G 10: 50,721,839 Y1268D probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Bub1 T C 2: 127,801,281 I1048V probably benign Het
Cad A G 5: 31,062,220 N621S probably damaging Het
Camkv C A 9: 107,945,600 N69K possibly damaging Het
Ccdc110 T C 8: 45,942,839 M589T probably benign Het
Ccdc154 T A 17: 25,170,890 V498E probably damaging Het
Ccr1l1 A G 9: 123,977,654 L252P probably damaging Het
Cdh1 T C 8: 106,664,321 C690R probably damaging Het
Cfap157 T G 2: 32,778,163 probably null Het
Cux2 A G 5: 121,887,477 S43P possibly damaging Het
Cyb5rl C T 4: 107,068,683 P21S probably damaging Het
Cyp51 T G 5: 4,086,594 Q400P probably damaging Het
Dnah7b T C 1: 46,097,992 probably benign Het
Ephb4 A G 5: 137,354,426 I90M probably benign Het
Fam13c A G 10: 70,542,693 N269S probably damaging Het
Fam83c T A 2: 155,831,524 Y248F possibly damaging Het
Fat2 A G 11: 55,303,716 F1166L probably benign Het
Fem1a A G 17: 56,257,686 N260D probably benign Het
Fnbp4 T A 2: 90,767,399 probably null Het
Fut9 T A 4: 25,619,733 *360Y probably null Het
Fut9 T A 4: 25,619,734 *360L probably null Het
Gm11639 G A 11: 104,751,862 V1104I possibly damaging Het
Gm3727 T A 14: 7,264,625 Q10L probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Haspin A C 11: 73,136,630 N544K probably damaging Het
Havcr1 A G 11: 46,778,552 N286S probably benign Het
Lrp6 A C 6: 134,459,283 C1307G probably damaging Het
Lrrc2 A C 9: 110,979,577 H294P possibly damaging Het
Mon2 A C 10: 123,042,364 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprb1 T C 7: 48,447,322 I281V probably benign Het
Muc4 A G 16: 32,750,476 E118G probably damaging Het
Nefh T C 11: 4,943,872 D394G probably damaging Het
Neurl4 A G 11: 69,903,221 T168A probably benign Het
Olfr347 T A 2: 36,734,701 C127S probably damaging Het
Olfr642 T C 7: 104,049,638 T239A probably benign Het
Olfr982 A G 9: 40,074,915 N207D possibly damaging Het
Olfr987 A T 2: 85,331,102 N265K probably benign Het
Oxsr1 A C 9: 119,294,432 M92R probably damaging Het
Pde8a T C 7: 81,295,768 probably null Het
Pex5l T A 3: 32,953,132 probably null Het
Pik3r4 T A 9: 105,672,785 M1025K probably benign Het
Plch1 C T 3: 63,698,482 E1325K probably benign Het
Plin2 A T 4: 86,668,432 V54E probably damaging Het
Pqlc3 G A 12: 16,989,839 L192F probably damaging Het
Prss47 A T 13: 65,045,073 I298N probably damaging Het
Prune2 A G 19: 17,120,182 R1017G probably benign Het
Psg19 T A 7: 18,796,986 Y81F possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rrnad1 A T 3: 87,927,053 probably null Het
Serpinb1a T C 13: 32,850,414 probably benign Het
Sh3pxd2a A T 19: 47,278,355 V265E probably damaging Het
Slc22a17 A T 14: 54,908,825 Y337* probably null Het
Slc25a27 A G 17: 43,657,772 V138A probably benign Het
Slc4a2 A G 5: 24,431,316 Y220C probably damaging Het
Stab1 A T 14: 31,168,435 S20T probably benign Het
Thsd1 G T 8: 22,238,522 probably benign Het
Tmem204 G A 17: 25,080,592 probably benign Het
Tom1l1 A G 11: 90,649,895 probably benign Het
Toporsl T A 4: 52,612,072 F655Y possibly damaging Het
Vmn2r98 A G 17: 19,081,291 K852E unknown Het
Wdpcp T G 11: 21,691,884 L174R probably damaging Het
Zbbx G A 3: 75,112,107 P99S probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp600 A T 4: 146,196,918 R719* probably null Het
Zfp697 C A 3: 98,428,014 A365E unknown Het
Zfp957 A C 14: 79,213,613 S249A probably benign Het
Other mutations in Bik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4568:Bik UTSW 15 83541444 critical splice donor site probably null
R5482:Bik UTSW 15 83544134 missense probably damaging 1.00
R6830:Bik UTSW 15 83544208 missense probably benign
R7270:Bik UTSW 15 83544163 missense possibly damaging 0.71
R7746:Bik UTSW 15 83541334 missense possibly damaging 0.60
R9749:Bik UTSW 15 83541339 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTACTATGGTCTGTAGCCACCGG -3'
(R):5'- CAGGTTCAGGCTGCATTGTG -3'

Sequencing Primer
(F):5'- TAGCCACCGGTGCATAGTTCTG -3'
(R):5'- ATTGTGCTGGTCCCGACAC -3'
Posted On 2014-10-01