Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Vmn2r98'

235464

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

MMRRC Submission

040168-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19081291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 852 (K852E)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

AlphaFold

E9PZ56

Predicted Effect

unknown
Transcript: ENSMUST00000170424
AA Change: K852E

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: K852E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1035:Vmn2r98	UTSW	17	19080749	missense	possibly damaging	0.90
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1643:Vmn2r98	UTSW	17	19080908	missense	probably damaging	1.00
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R2909:Vmn2r98	UTSW	17	19067402	missense	probably damaging	1.00
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3788:Vmn2r98	UTSW	17	19080625	missense	probably benign	0.31
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5036:Vmn2r98	UTSW	17	19066157	missense	probably benign	0.00
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5598:Vmn2r98	UTSW	17	19080899	missense	probably benign	0.37
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7012:Vmn2r98	UTSW	17	19066268	missense	probably benign	0.06
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R7915:Vmn2r98	UTSW	17	19067231	missense	probably benign	0.10
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
R8906:Vmn2r98	UTSW	17	19066270	missense	probably benign
R8952:Vmn2r98	UTSW	17	19065269	missense	possibly damaging	0.76
R9147:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9148:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9187:Vmn2r98	UTSW	17	19081219	missense	probably damaging	1.00
R9344:Vmn2r98	UTSW	17	19066515	missense	probably benign	0.14
R9467:Vmn2r98	UTSW	17	19067255	missense	probably benign	0.01
R9487:Vmn2r98	UTSW	17	19081234	missense	possibly damaging	0.78
R9753:Vmn2r98	UTSW	17	19065403	missense	probably benign	0.27
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCTACCACAGCACTAAAGG -3'
(R):5'- TGCTATGAACTAGAATGCCATGTC -3'

Sequencing Primer
(F):5'- TGTCTACCACAGCACTAAAGGAAAGG -3'
(R):5'- TTCAGGAAGAAGAAAGAATTCTCATG -3'

Posted On

2014-10-01