Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Adgre1'

235469

Institutional Source

Beutler Lab

Gene Symbol

Adgre1

Ensembl Gene

ENSMUSG00000004730

Gene Name

adhesion G protein-coupled receptor E1

Synonyms

Emr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71

MMRRC Submission

040168-MU

Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57358686-57483529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 57419338 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 403 (L403R)

Ref Sequence

ENSEMBL: ENSMUSP00000083971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]

AlphaFold

Q61549

Predicted Effect

probably damaging
Transcript: ENSMUST00000004850
AA Change: L403R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: L403R

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086763
AA Change: L403R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: L403R

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Adgre1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Adgre1	APN	17	57450055	missense	probably benign	0.00
IGL00966:Adgre1	APN	17	57419335	missense	probably benign	0.04
IGL01680:Adgre1	APN	17	57402620	missense	unknown
IGL01724:Adgre1	APN	17	57444064	nonsense	probably null
IGL02172:Adgre1	APN	17	57478879	missense	probably damaging	1.00
IGL02260:Adgre1	APN	17	57447891	missense	probably benign	0.01
IGL02272:Adgre1	APN	17	57450021	nonsense	probably null
IGL02336:Adgre1	APN	17	57411024	nonsense	probably null
IGL02346:Adgre1	APN	17	57443919	missense	probably benign	0.15
IGL02398:Adgre1	APN	17	57402824	nonsense	probably null
IGL02618:Adgre1	APN	17	57444021	missense	possibly damaging	0.66
IGL02690:Adgre1	APN	17	57480921	missense	probably damaging	1.00
IGL02936:Adgre1	APN	17	57478833	missense	probably benign	0.26
IGL03112:Adgre1	APN	17	57448029	splice site	probably null
IGL03350:Adgre1	APN	17	57401908	missense	probably benign	0.16
F480	UTSW	17	57444063	missense	probably damaging	1.00
lomax	UTSW	17	57402811	missense	unknown
Onion	UTSW	17	57402841	nonsense	probably null
Scallion	UTSW	17	57401977	missense	possibly damaging	0.90
R0049:Adgre1	UTSW	17	57402841	nonsense	probably null
R0153:Adgre1	UTSW	17	57443939	missense	possibly damaging	0.92
R0277:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0278:Adgre1	UTSW	17	57447872	missense	probably benign	0.07
R0323:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0389:Adgre1	UTSW	17	57406839	missense	possibly damaging	0.80
R0492:Adgre1	UTSW	17	57402742	missense	unknown
R0621:Adgre1	UTSW	17	57441359	missense	probably damaging	0.98
R0647:Adgre1	UTSW	17	57411003	missense	probably damaging	1.00
R1310:Adgre1	UTSW	17	57447936	missense	probably benign	0.00
R1601:Adgre1	UTSW	17	57441353	missense	probably benign	0.01
R1689:Adgre1	UTSW	17	57449921	missense	probably benign	0.31
R1708:Adgre1	UTSW	17	57401974	missense	possibly damaging	0.93
R1796:Adgre1	UTSW	17	57441350	missense	probably benign	0.43
R1839:Adgre1	UTSW	17	57441299	missense	probably benign	0.00
R1860:Adgre1	UTSW	17	57441363	missense	probably benign	0.00
R2219:Adgre1	UTSW	17	57401912	missense	possibly damaging	0.92
R2519:Adgre1	UTSW	17	57410956	missense	probably damaging	1.00
R3874:Adgre1	UTSW	17	57401925	missense	probably benign	0.08
R3911:Adgre1	UTSW	17	57447860	missense	probably damaging	1.00
R4190:Adgre1	UTSW	17	57402811	missense	unknown
R4439:Adgre1	UTSW	17	57447954	missense	probably damaging	1.00
R4513:Adgre1	UTSW	17	57410947	missense	probably benign	0.34
R4529:Adgre1	UTSW	17	57420519	missense	possibly damaging	0.92
R4543:Adgre1	UTSW	17	57406874	missense	probably benign	0.07
R4610:Adgre1	UTSW	17	57450073	missense	possibly damaging	0.50
R4665:Adgre1	UTSW	17	57480947	missense	probably benign	0.20
R4911:Adgre1	UTSW	17	57447832	missense	possibly damaging	0.57
R4928:Adgre1	UTSW	17	57444064	nonsense	probably null
R4942:Adgre1	UTSW	17	57406903	missense	probably damaging	1.00
R4946:Adgre1	UTSW	17	57443918	missense	probably benign	0.33
R4953:Adgre1	UTSW	17	57441321	missense	probably damaging	0.99
R5107:Adgre1	UTSW	17	57401977	missense	possibly damaging	0.90
R5366:Adgre1	UTSW	17	57402817	missense	probably benign	0.39
R5590:Adgre1	UTSW	17	57445034	missense	probably damaging	1.00
R5619:Adgre1	UTSW	17	57420437	missense	probably benign	0.15
R5699:Adgre1	UTSW	17	57481007	missense	probably benign	0.43
R5734:Adgre1	UTSW	17	57443990	missense	probably benign	0.00
R5860:Adgre1	UTSW	17	57445034	missense	probably damaging	1.00
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6149:Adgre1	UTSW	17	57445018	missense	probably benign	0.08
R6478:Adgre1	UTSW	17	57401955	missense	possibly damaging	0.81
R6709:Adgre1	UTSW	17	57406917	missense	probably benign	0.10
R6864:Adgre1	UTSW	17	57478879	missense	probably damaging	1.00
R6945:Adgre1	UTSW	17	57410844	missense	probably benign	0.01
R6945:Adgre1	UTSW	17	57420399	missense	probably benign	0.39
R6988:Adgre1	UTSW	17	57408445	missense	probably benign	0.00
R7019:Adgre1	UTSW	17	57410945	missense	probably damaging	0.98
R7154:Adgre1	UTSW	17	57444087	splice site	probably null
R7347:Adgre1	UTSW	17	57420441	missense	probably damaging	1.00
R7459:Adgre1	UTSW	17	57449933	missense	probably damaging	1.00
R7709:Adgre1	UTSW	17	57402519	missense	unknown
R7939:Adgre1	UTSW	17	57449938	missense	probably damaging	0.98
R7977:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R7987:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R8187:Adgre1	UTSW	17	57420349	missense	probably benign	0.00
R8210:Adgre1	UTSW	17	57445061	missense	possibly damaging	0.94
R8223:Adgre1	UTSW	17	57361692	missense	probably damaging	0.99
R8344:Adgre1	UTSW	17	57408459	missense	probably benign	0.12
R8698:Adgre1	UTSW	17	57402003	missense	probably benign	0.05
R9236:Adgre1	UTSW	17	57402782	nonsense	probably null
R9262:Adgre1	UTSW	17	57447941	missense	probably damaging	1.00
R9303:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
R9305:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
R9605:Adgre1	UTSW	17	57411083	missense	probably benign	0.00
R9661:Adgre1	UTSW	17	57441368	missense	possibly damaging	0.70
R9678:Adgre1	UTSW	17	57443997	missense	probably damaging	0.96
R9751:Adgre1	UTSW	17	57450101	missense	probably null	0.06
R9785:Adgre1	UTSW	17	57478930	missense	probably damaging	1.00
Z1176:Adgre1	UTSW	17	57361729	missense	possibly damaging	0.76
Z1177:Adgre1	UTSW	17	57419374	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGTTATCTGCCACCCAGCTT -3'
(R):5'- TGAAGCAAAAGAAGACGCTACT -3'

Sequencing Primer
(F):5'- CCCAGCTTCTCTGAAATGAGG -3'
(R):5'- GGTCTTGCAAACTTTATATGCCTCAG -3'

Posted On

2014-10-01