Incidental Mutation 'R2165:Adgre1'
ID 235469
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Name adhesion G protein-coupled receptor E1
Synonyms DD7A5-7, EGF-TM7, Emr1, Ly71, F4/80, TM7LN3
MMRRC Submission 040168-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R2165 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 57665691-57790527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 57726338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 403 (L403R)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
AlphaFold Q61549
Predicted Effect probably damaging
Transcript: ENSMUST00000004850
AA Change: L403R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: L403R

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086763
AA Change: L403R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: L403R

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,906,048 (GRCm39) T806A possibly damaging Het
Alox12 A T 11: 70,133,398 (GRCm39) probably null Het
Ankib1 A T 5: 3,763,210 (GRCm39) D506E possibly damaging Het
Ascc3 T G 10: 50,597,935 (GRCm39) Y1268D probably damaging Het
Bik A G 15: 83,425,624 (GRCm39) M42V probably benign Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Bub1 T C 2: 127,643,201 (GRCm39) I1048V probably benign Het
Cad A G 5: 31,219,564 (GRCm39) N621S probably damaging Het
Camkv C A 9: 107,822,799 (GRCm39) N69K possibly damaging Het
Ccdc110 T C 8: 46,395,876 (GRCm39) M589T probably benign Het
Ccdc154 T A 17: 25,389,864 (GRCm39) V498E probably damaging Het
Ccr1l1 A G 9: 123,777,691 (GRCm39) L252P probably damaging Het
Cdh1 T C 8: 107,390,953 (GRCm39) C690R probably damaging Het
Cfap157 T G 2: 32,668,175 (GRCm39) probably null Het
Cux2 A G 5: 122,025,540 (GRCm39) S43P possibly damaging Het
Cyb5rl C T 4: 106,925,880 (GRCm39) P21S probably damaging Het
Cyp51 T G 5: 4,136,594 (GRCm39) Q400P probably damaging Het
Dnah7b T C 1: 46,137,152 (GRCm39) probably benign Het
Efcab3 G A 11: 104,642,688 (GRCm39) V1104I possibly damaging Het
Ephb4 A G 5: 137,352,688 (GRCm39) I90M probably benign Het
Fam13c A G 10: 70,378,523 (GRCm39) N269S probably damaging Het
Fam83c T A 2: 155,673,444 (GRCm39) Y248F possibly damaging Het
Fat2 A G 11: 55,194,542 (GRCm39) F1166L probably benign Het
Fem1a A G 17: 56,564,686 (GRCm39) N260D probably benign Het
Fnbp4 T A 2: 90,597,743 (GRCm39) probably null Het
Fut9 T A 4: 25,619,733 (GRCm39) *360Y probably null Het
Fut9 T A 4: 25,619,734 (GRCm39) *360L probably null Het
Gm3727 T A 14: 7,264,625 (GRCm38) Q10L probably damaging Het
Gpat2 G A 2: 127,270,211 (GRCm39) V75M probably damaging Het
Haspin A C 11: 73,027,456 (GRCm39) N544K probably damaging Het
Havcr1 A G 11: 46,669,379 (GRCm39) N286S probably benign Het
Lrp6 A C 6: 134,436,246 (GRCm39) C1307G probably damaging Het
Lrrc2 A C 9: 110,808,645 (GRCm39) H294P possibly damaging Het
Mettl25b A T 3: 87,834,360 (GRCm39) probably null Het
Mon2 A C 10: 122,878,269 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrgprb1 T C 7: 48,097,070 (GRCm39) I281V probably benign Het
Muc4 A G 16: 32,569,294 (GRCm39) E118G probably damaging Het
Nefh T C 11: 4,893,872 (GRCm39) D394G probably damaging Het
Neurl4 A G 11: 69,794,047 (GRCm39) T168A probably benign Het
Or10s1 A G 9: 39,986,211 (GRCm39) N207D possibly damaging Het
Or1j18 T A 2: 36,624,713 (GRCm39) C127S probably damaging Het
Or51a10 T C 7: 103,698,845 (GRCm39) T239A probably benign Het
Or5ak4 A T 2: 85,161,446 (GRCm39) N265K probably benign Het
Oxsr1 A C 9: 119,123,498 (GRCm39) M92R probably damaging Het
Pde8a T C 7: 80,945,516 (GRCm39) probably null Het
Pex5l T A 3: 33,007,281 (GRCm39) probably null Het
Pik3r4 T A 9: 105,549,984 (GRCm39) M1025K probably benign Het
Plch1 C T 3: 63,605,903 (GRCm39) E1325K probably benign Het
Plin2 A T 4: 86,586,669 (GRCm39) V54E probably damaging Het
Prss47 A T 13: 65,192,887 (GRCm39) I298N probably damaging Het
Prune2 A G 19: 17,097,546 (GRCm39) R1017G probably benign Het
Psg19 T A 7: 18,530,911 (GRCm39) Y81F possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Serpinb1a T C 13: 33,034,397 (GRCm39) probably benign Het
Sh3pxd2a A T 19: 47,266,794 (GRCm39) V265E probably damaging Het
Slc22a17 A T 14: 55,146,282 (GRCm39) Y337* probably null Het
Slc25a27 A G 17: 43,968,663 (GRCm39) V138A probably benign Het
Slc4a2 A G 5: 24,636,314 (GRCm39) Y220C probably damaging Het
Slc66a3 G A 12: 17,039,840 (GRCm39) L192F probably damaging Het
Stab1 A T 14: 30,890,392 (GRCm39) S20T probably benign Het
Tcstv2a A T 13: 120,725,633 (GRCm39) Q99L probably damaging Het
Thsd1 G T 8: 22,728,538 (GRCm39) probably benign Het
Tmem204 G A 17: 25,299,566 (GRCm39) probably benign Het
Tom1l1 A G 11: 90,540,721 (GRCm39) probably benign Het
Toporsl T A 4: 52,612,072 (GRCm39) F655Y possibly damaging Het
Vmn2r98 A G 17: 19,301,553 (GRCm39) K852E unknown Het
Wdpcp T G 11: 21,641,884 (GRCm39) L174R probably damaging Het
Zbbx G A 3: 75,019,414 (GRCm39) P99S probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp600 A T 4: 146,133,488 (GRCm39) R719* probably null Het
Zfp697 C A 3: 98,335,330 (GRCm39) A365E unknown Het
Zfp957 A C 14: 79,451,053 (GRCm39) S249A probably benign Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57,757,055 (GRCm39) missense probably benign 0.00
IGL00966:Adgre1 APN 17 57,726,335 (GRCm39) missense probably benign 0.04
IGL01680:Adgre1 APN 17 57,709,620 (GRCm39) missense unknown
IGL01724:Adgre1 APN 17 57,751,064 (GRCm39) nonsense probably null
IGL02172:Adgre1 APN 17 57,785,879 (GRCm39) missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57,754,891 (GRCm39) missense probably benign 0.01
IGL02272:Adgre1 APN 17 57,757,021 (GRCm39) nonsense probably null
IGL02336:Adgre1 APN 17 57,718,024 (GRCm39) nonsense probably null
IGL02346:Adgre1 APN 17 57,750,919 (GRCm39) missense probably benign 0.15
IGL02398:Adgre1 APN 17 57,709,824 (GRCm39) nonsense probably null
IGL02618:Adgre1 APN 17 57,751,021 (GRCm39) missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57,787,921 (GRCm39) missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57,785,833 (GRCm39) missense probably benign 0.26
IGL03112:Adgre1 APN 17 57,755,029 (GRCm39) splice site probably null
IGL03350:Adgre1 APN 17 57,708,908 (GRCm39) missense probably benign 0.16
F480 UTSW 17 57,751,063 (GRCm39) missense probably damaging 1.00
lomax UTSW 17 57,709,811 (GRCm39) missense unknown
Onion UTSW 17 57,709,841 (GRCm39) nonsense probably null
Scallion UTSW 17 57,708,977 (GRCm39) missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57,709,841 (GRCm39) nonsense probably null
R0153:Adgre1 UTSW 17 57,750,939 (GRCm39) missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57,751,060 (GRCm39) missense probably benign 0.00
R0278:Adgre1 UTSW 17 57,754,872 (GRCm39) missense probably benign 0.07
R0323:Adgre1 UTSW 17 57,751,060 (GRCm39) missense probably benign 0.00
R0389:Adgre1 UTSW 17 57,713,839 (GRCm39) missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57,709,742 (GRCm39) missense unknown
R0621:Adgre1 UTSW 17 57,748,359 (GRCm39) missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57,718,003 (GRCm39) missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57,754,936 (GRCm39) missense probably benign 0.00
R1601:Adgre1 UTSW 17 57,748,353 (GRCm39) missense probably benign 0.01
R1689:Adgre1 UTSW 17 57,756,921 (GRCm39) missense probably benign 0.31
R1708:Adgre1 UTSW 17 57,708,974 (GRCm39) missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57,748,350 (GRCm39) missense probably benign 0.43
R1839:Adgre1 UTSW 17 57,748,299 (GRCm39) missense probably benign 0.00
R1860:Adgre1 UTSW 17 57,748,363 (GRCm39) missense probably benign 0.00
R2219:Adgre1 UTSW 17 57,708,912 (GRCm39) missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57,717,956 (GRCm39) missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57,708,925 (GRCm39) missense probably benign 0.08
R3911:Adgre1 UTSW 17 57,754,860 (GRCm39) missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57,709,811 (GRCm39) missense unknown
R4439:Adgre1 UTSW 17 57,754,954 (GRCm39) missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57,717,947 (GRCm39) missense probably benign 0.34
R4529:Adgre1 UTSW 17 57,727,519 (GRCm39) missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57,713,874 (GRCm39) missense probably benign 0.07
R4610:Adgre1 UTSW 17 57,757,073 (GRCm39) missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57,787,947 (GRCm39) missense probably benign 0.20
R4911:Adgre1 UTSW 17 57,754,832 (GRCm39) missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57,751,064 (GRCm39) nonsense probably null
R4942:Adgre1 UTSW 17 57,713,903 (GRCm39) missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57,750,918 (GRCm39) missense probably benign 0.33
R4953:Adgre1 UTSW 17 57,748,321 (GRCm39) missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57,708,977 (GRCm39) missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57,709,817 (GRCm39) missense probably benign 0.39
R5590:Adgre1 UTSW 17 57,752,034 (GRCm39) missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57,727,437 (GRCm39) missense probably benign 0.15
R5699:Adgre1 UTSW 17 57,788,007 (GRCm39) missense probably benign 0.43
R5734:Adgre1 UTSW 17 57,750,990 (GRCm39) missense probably benign 0.00
R5860:Adgre1 UTSW 17 57,752,034 (GRCm39) missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57,713,859 (GRCm39) missense probably benign 0.28
R6039:Adgre1 UTSW 17 57,713,859 (GRCm39) missense probably benign 0.28
R6149:Adgre1 UTSW 17 57,752,018 (GRCm39) missense probably benign 0.08
R6478:Adgre1 UTSW 17 57,708,955 (GRCm39) missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57,713,917 (GRCm39) missense probably benign 0.10
R6864:Adgre1 UTSW 17 57,785,879 (GRCm39) missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57,727,399 (GRCm39) missense probably benign 0.39
R6945:Adgre1 UTSW 17 57,717,844 (GRCm39) missense probably benign 0.01
R6988:Adgre1 UTSW 17 57,715,445 (GRCm39) missense probably benign 0.00
R7019:Adgre1 UTSW 17 57,717,945 (GRCm39) missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57,751,087 (GRCm39) splice site probably null
R7347:Adgre1 UTSW 17 57,727,441 (GRCm39) missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57,756,933 (GRCm39) missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57,709,519 (GRCm39) missense unknown
R7939:Adgre1 UTSW 17 57,756,938 (GRCm39) missense probably damaging 0.98
R7977:Adgre1 UTSW 17 57,754,987 (GRCm39) missense possibly damaging 0.54
R7987:Adgre1 UTSW 17 57,754,987 (GRCm39) missense possibly damaging 0.54
R8187:Adgre1 UTSW 17 57,727,349 (GRCm39) missense probably benign 0.00
R8210:Adgre1 UTSW 17 57,752,061 (GRCm39) missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57,668,692 (GRCm39) missense probably damaging 0.99
R8344:Adgre1 UTSW 17 57,715,459 (GRCm39) missense probably benign 0.12
R8698:Adgre1 UTSW 17 57,709,003 (GRCm39) missense probably benign 0.05
R9236:Adgre1 UTSW 17 57,709,782 (GRCm39) nonsense probably null
R9262:Adgre1 UTSW 17 57,754,941 (GRCm39) missense probably damaging 1.00
R9303:Adgre1 UTSW 17 57,748,275 (GRCm39) missense probably benign 0.00
R9305:Adgre1 UTSW 17 57,748,275 (GRCm39) missense probably benign 0.00
R9605:Adgre1 UTSW 17 57,718,083 (GRCm39) missense probably benign 0.00
R9661:Adgre1 UTSW 17 57,748,368 (GRCm39) missense possibly damaging 0.70
R9678:Adgre1 UTSW 17 57,750,997 (GRCm39) missense probably damaging 0.96
R9751:Adgre1 UTSW 17 57,757,101 (GRCm39) missense probably null 0.06
R9785:Adgre1 UTSW 17 57,785,930 (GRCm39) missense probably damaging 1.00
Z1176:Adgre1 UTSW 17 57,668,729 (GRCm39) missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57,726,374 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTTATCTGCCACCCAGCTT -3'
(R):5'- TGAAGCAAAAGAAGACGCTACT -3'

Sequencing Primer
(F):5'- CCCAGCTTCTCTGAAATGAGG -3'
(R):5'- GGTCTTGCAAACTTTATATGCCTCAG -3'
Posted On 2014-10-01