Incidental Mutation 'R2165:Sh3pxd2a'
ID235472
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2a
Ensembl Gene ENSMUSG00000053617
Gene NameSH3 and PX domains 2A
SynonymsTks5, Fish, Sh3md1, 2310014D11Rik
MMRRC Submission 040168-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2165 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47260174-47464411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47278355 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 265 (V265E)
Ref Sequence ENSEMBL: ENSMUSP00000107430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]
Predicted Effect probably damaging
Transcript: ENSMUST00000081619
AA Change: V293E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: V293E

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
low complexity region 242 254 N/A INTRINSIC
SH3 269 324 6.49e-16 SMART
low complexity region 360 371 N/A INTRINSIC
SH3 450 505 4.49e-10 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 654 676 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
SH3 836 891 2.41e-10 SMART
SH3 1066 1124 3.85e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111800
AA Change: V265E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: V265E

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
SH3 241 296 6.49e-16 SMART
low complexity region 332 343 N/A INTRINSIC
SH3 422 477 4.49e-10 SMART
low complexity region 491 509 N/A INTRINSIC
low complexity region 604 624 N/A INTRINSIC
low complexity region 626 648 N/A INTRINSIC
low complexity region 657 681 N/A INTRINSIC
SH3 808 863 2.41e-10 SMART
SH3 1038 1096 3.85e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183658
Meta Mutation Damage Score 0.9731 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,112,399 T806A possibly damaging Het
Adgre1 T G 17: 57,419,338 L403R probably damaging Het
AF067061 A T 13: 120,264,097 Q99L probably damaging Het
Alox12 A T 11: 70,242,572 probably null Het
Ankib1 A T 5: 3,713,210 D506E possibly damaging Het
Ascc3 T G 10: 50,721,839 Y1268D probably damaging Het
Bik A G 15: 83,541,423 M42V probably benign Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Bub1 T C 2: 127,801,281 I1048V probably benign Het
Cad A G 5: 31,062,220 N621S probably damaging Het
Camkv C A 9: 107,945,600 N69K possibly damaging Het
Ccdc110 T C 8: 45,942,839 M589T probably benign Het
Ccdc154 T A 17: 25,170,890 V498E probably damaging Het
Ccr1l1 A G 9: 123,977,654 L252P probably damaging Het
Cdh1 T C 8: 106,664,321 C690R probably damaging Het
Cfap157 T G 2: 32,778,163 probably null Het
Cux2 A G 5: 121,887,477 S43P possibly damaging Het
Cyb5rl C T 4: 107,068,683 P21S probably damaging Het
Cyp51 T G 5: 4,086,594 Q400P probably damaging Het
Dnah7b T C 1: 46,097,992 probably benign Het
Ephb4 A G 5: 137,354,426 I90M probably benign Het
Fam13c A G 10: 70,542,693 N269S probably damaging Het
Fam83c T A 2: 155,831,524 Y248F possibly damaging Het
Fat2 A G 11: 55,303,716 F1166L probably benign Het
Fem1a A G 17: 56,257,686 N260D probably benign Het
Fnbp4 T A 2: 90,767,399 probably null Het
Fut9 T A 4: 25,619,733 *360Y probably null Het
Fut9 T A 4: 25,619,734 *360L probably null Het
Gm11639 G A 11: 104,751,862 V1104I possibly damaging Het
Gm3727 T A 14: 7,264,625 Q10L probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Haspin A C 11: 73,136,630 N544K probably damaging Het
Havcr1 A G 11: 46,778,552 N286S probably benign Het
Lrp6 A C 6: 134,459,283 C1307G probably damaging Het
Lrrc2 A C 9: 110,979,577 H294P possibly damaging Het
Mon2 A C 10: 123,042,364 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprb1 T C 7: 48,447,322 I281V probably benign Het
Muc4 A G 16: 32,750,476 E118G probably damaging Het
Nefh T C 11: 4,943,872 D394G probably damaging Het
Neurl4 A G 11: 69,903,221 T168A probably benign Het
Olfr347 T A 2: 36,734,701 C127S probably damaging Het
Olfr642 T C 7: 104,049,638 T239A probably benign Het
Olfr982 A G 9: 40,074,915 N207D possibly damaging Het
Olfr987 A T 2: 85,331,102 N265K probably benign Het
Oxsr1 A C 9: 119,294,432 M92R probably damaging Het
Pde8a T C 7: 81,295,768 probably null Het
Pex5l T A 3: 32,953,132 probably null Het
Pik3r4 T A 9: 105,672,785 M1025K probably benign Het
Plch1 C T 3: 63,698,482 E1325K probably benign Het
Plin2 A T 4: 86,668,432 V54E probably damaging Het
Pqlc3 G A 12: 16,989,839 L192F probably damaging Het
Prss47 A T 13: 65,045,073 I298N probably damaging Het
Prune2 A G 19: 17,120,182 R1017G probably benign Het
Psg19 T A 7: 18,796,986 Y81F possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rrnad1 A T 3: 87,927,053 probably null Het
Serpinb1a T C 13: 32,850,414 probably benign Het
Slc22a17 A T 14: 54,908,825 Y337* probably null Het
Slc25a27 A G 17: 43,657,772 V138A probably benign Het
Slc4a2 A G 5: 24,431,316 Y220C probably damaging Het
Stab1 A T 14: 31,168,435 S20T probably benign Het
Thsd1 G T 8: 22,238,522 probably benign Het
Tmem204 G A 17: 25,080,592 probably benign Het
Tom1l1 A G 11: 90,649,895 probably benign Het
Toporsl T A 4: 52,612,072 F655Y possibly damaging Het
Vmn2r98 A G 17: 19,081,291 K852E unknown Het
Wdpcp T G 11: 21,691,884 L174R probably damaging Het
Zbbx G A 3: 75,112,107 P99S probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp600 A T 4: 146,196,918 R719* probably null Het
Zfp697 C A 3: 98,428,014 A365E unknown Het
Zfp957 A C 14: 79,213,613 S249A probably benign Het
Other mutations in Sh3pxd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Sh3pxd2a APN 19 47314155 missense probably benign 0.20
IGL01606:Sh3pxd2a APN 19 47268596 missense probably benign
IGL02001:Sh3pxd2a APN 19 47273447 missense probably damaging 0.99
IGL02060:Sh3pxd2a APN 19 47373378 splice site probably benign
IGL02830:Sh3pxd2a APN 19 47283078 missense probably damaging 1.00
IGL03240:Sh3pxd2a APN 19 47268026 missense probably damaging 1.00
IGL03263:Sh3pxd2a APN 19 47314043 missense probably damaging 1.00
IGL03290:Sh3pxd2a APN 19 47424516 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0504:Sh3pxd2a UTSW 19 47267747 missense probably damaging 1.00
R0683:Sh3pxd2a UTSW 19 47267511 missense probably benign 0.04
R0726:Sh3pxd2a UTSW 19 47268762 missense probably damaging 1.00
R0883:Sh3pxd2a UTSW 19 47268207 missense probably damaging 1.00
R1276:Sh3pxd2a UTSW 19 47268383 missense probably benign
R1349:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1372:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1525:Sh3pxd2a UTSW 19 47278425 missense probably damaging 1.00
R1661:Sh3pxd2a UTSW 19 47278320 missense probably damaging 1.00
R1664:Sh3pxd2a UTSW 19 47268382 missense probably benign 0.02
R1766:Sh3pxd2a UTSW 19 47273250 missense probably benign 0.01
R1931:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R1932:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R2024:Sh3pxd2a UTSW 19 47267264 missense probably benign 0.35
R2210:Sh3pxd2a UTSW 19 47267343 missense possibly damaging 0.93
R2567:Sh3pxd2a UTSW 19 47424569 missense possibly damaging 0.94
R4097:Sh3pxd2a UTSW 19 47424512 missense probably damaging 1.00
R4466:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R4788:Sh3pxd2a UTSW 19 47314079 missense probably damaging 1.00
R4885:Sh3pxd2a UTSW 19 47268693 missense probably damaging 1.00
R4939:Sh3pxd2a UTSW 19 47278404 missense probably damaging 1.00
R5184:Sh3pxd2a UTSW 19 47273411 missense possibly damaging 0.90
R5340:Sh3pxd2a UTSW 19 47268231 missense probably benign 0.36
R5673:Sh3pxd2a UTSW 19 47268666 missense probably damaging 1.00
R5925:Sh3pxd2a UTSW 19 47267612 missense probably damaging 1.00
R5988:Sh3pxd2a UTSW 19 47364638 missense probably benign 0.16
R6120:Sh3pxd2a UTSW 19 47267409 missense probably damaging 0.99
R6432:Sh3pxd2a UTSW 19 47269927 missense probably damaging 0.99
R6650:Sh3pxd2a UTSW 19 47268224 missense probably benign 0.00
R6700:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R6831:Sh3pxd2a UTSW 19 47283093 missense probably damaging 1.00
R7015:Sh3pxd2a UTSW 19 47268123 missense probably benign 0.00
R7225:Sh3pxd2a UTSW 19 47267389 missense probably damaging 1.00
R7449:Sh3pxd2a UTSW 19 47267652 missense probably benign
R7695:Sh3pxd2a UTSW 19 47267831 missense probably damaging 1.00
V3553:Sh3pxd2a UTSW 19 47267219 missense probably benign 0.12
X0013:Sh3pxd2a UTSW 19 47267864 missense probably benign 0.01
X0026:Sh3pxd2a UTSW 19 47464150 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAACTCTTGGCTGTGCATGG -3'
(R):5'- AGTTAGTACGAGGCTGAGCG -3'

Sequencing Primer
(F):5'- AAGGGGATCACAGACTGCCTC -3'
(R):5'- CACAGCCTCAGATTAACTGT -3'
Posted On2014-10-01