Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Sh3pxd2a'

235472

Institutional Source

Beutler Lab

Gene Symbol

Sh3pxd2a

Ensembl Gene

ENSMUSG00000053617

Gene Name

SH3 and PX domains 2A

Synonyms

Tks5, Fish, Sh3md1, 2310014D11Rik

MMRRC Submission

040168-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47260174-47464411 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47278355 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 265 (V265E)

Ref Sequence

ENSEMBL: ENSMUSP00000107430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]

AlphaFold

O89032

Predicted Effect

probably damaging
Transcript: ENSMUST00000081619
AA Change: V293E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: V293E

Domain	Start	End	E-Value	Type
PX	3	124	3.6e-32	SMART
SH3	169	224	3.24e-16	SMART
low complexity region	242	254	N/A	INTRINSIC
SH3	269	324	6.49e-16	SMART
low complexity region	360	371	N/A	INTRINSIC
SH3	450	505	4.49e-10	SMART
low complexity region	519	537	N/A	INTRINSIC
low complexity region	632	652	N/A	INTRINSIC
low complexity region	654	676	N/A	INTRINSIC
low complexity region	685	709	N/A	INTRINSIC
SH3	836	891	2.41e-10	SMART
SH3	1066	1124	3.85e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111800
AA Change: V265E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: V265E

Domain	Start	End	E-Value	Type
PX	3	124	3.6e-32	SMART
SH3	169	224	3.24e-16	SMART
SH3	241	296	6.49e-16	SMART
low complexity region	332	343	N/A	INTRINSIC
SH3	422	477	4.49e-10	SMART
low complexity region	491	509	N/A	INTRINSIC
low complexity region	604	624	N/A	INTRINSIC
low complexity region	626	648	N/A	INTRINSIC
low complexity region	657	681	N/A	INTRINSIC
SH3	808	863	2.41e-10	SMART
SH3	1038	1096	3.85e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183658

Meta Mutation Damage Score

0.9731

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Pik3r4	T	A	9: 105,672,785	M1025K	probably benign	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Sh3pxd2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Sh3pxd2a	APN	19	47314155	missense	probably benign	0.20
IGL01606:Sh3pxd2a	APN	19	47268596	missense	probably benign
IGL02001:Sh3pxd2a	APN	19	47273447	missense	probably damaging	0.99
IGL02060:Sh3pxd2a	APN	19	47373378	splice site	probably benign
IGL02830:Sh3pxd2a	APN	19	47283078	missense	probably damaging	1.00
IGL03240:Sh3pxd2a	APN	19	47268026	missense	probably damaging	1.00
IGL03263:Sh3pxd2a	APN	19	47314043	missense	probably damaging	1.00
IGL03290:Sh3pxd2a	APN	19	47424516	missense	probably damaging	1.00
R0045:Sh3pxd2a	UTSW	19	47267183	missense	probably damaging	1.00
R0045:Sh3pxd2a	UTSW	19	47267183	missense	probably damaging	1.00
R0504:Sh3pxd2a	UTSW	19	47267747	missense	probably damaging	1.00
R0683:Sh3pxd2a	UTSW	19	47267511	missense	probably benign	0.04
R0726:Sh3pxd2a	UTSW	19	47268762	missense	probably damaging	1.00
R0883:Sh3pxd2a	UTSW	19	47268207	missense	probably damaging	1.00
R1276:Sh3pxd2a	UTSW	19	47268383	missense	probably benign
R1349:Sh3pxd2a	UTSW	19	47267721	missense	probably damaging	1.00
R1372:Sh3pxd2a	UTSW	19	47267721	missense	probably damaging	1.00
R1525:Sh3pxd2a	UTSW	19	47278425	missense	probably damaging	1.00
R1661:Sh3pxd2a	UTSW	19	47278320	missense	probably damaging	1.00
R1664:Sh3pxd2a	UTSW	19	47268382	missense	probably benign	0.02
R1766:Sh3pxd2a	UTSW	19	47273250	missense	probably benign	0.01
R1931:Sh3pxd2a	UTSW	19	47267508	missense	probably benign	0.00
R1932:Sh3pxd2a	UTSW	19	47267508	missense	probably benign	0.00
R2024:Sh3pxd2a	UTSW	19	47267264	missense	probably benign	0.35
R2210:Sh3pxd2a	UTSW	19	47267343	missense	possibly damaging	0.93
R2567:Sh3pxd2a	UTSW	19	47424569	missense	possibly damaging	0.94
R4097:Sh3pxd2a	UTSW	19	47424512	missense	probably damaging	1.00
R4466:Sh3pxd2a	UTSW	19	47364707	missense	possibly damaging	0.61
R4788:Sh3pxd2a	UTSW	19	47314079	missense	probably damaging	1.00
R4885:Sh3pxd2a	UTSW	19	47268693	missense	probably damaging	1.00
R4939:Sh3pxd2a	UTSW	19	47278404	missense	probably damaging	1.00
R5184:Sh3pxd2a	UTSW	19	47273411	missense	possibly damaging	0.90
R5340:Sh3pxd2a	UTSW	19	47268231	missense	probably benign	0.36
R5673:Sh3pxd2a	UTSW	19	47268666	missense	probably damaging	1.00
R5925:Sh3pxd2a	UTSW	19	47267612	missense	probably damaging	1.00
R5988:Sh3pxd2a	UTSW	19	47364638	missense	probably benign	0.16
R6120:Sh3pxd2a	UTSW	19	47267409	missense	probably damaging	0.99
R6432:Sh3pxd2a	UTSW	19	47269927	missense	probably damaging	0.99
R6650:Sh3pxd2a	UTSW	19	47268224	missense	probably benign	0.00
R6700:Sh3pxd2a	UTSW	19	47364707	missense	possibly damaging	0.61
R6831:Sh3pxd2a	UTSW	19	47283093	missense	probably damaging	1.00
R7015:Sh3pxd2a	UTSW	19	47268123	missense	probably benign	0.00
R7225:Sh3pxd2a	UTSW	19	47267389	missense	probably damaging	1.00
R7449:Sh3pxd2a	UTSW	19	47267652	missense	probably benign
R7695:Sh3pxd2a	UTSW	19	47267831	missense	probably damaging	1.00
R7904:Sh3pxd2a	UTSW	19	47320314	missense	possibly damaging	0.54
R8143:Sh3pxd2a	UTSW	19	47268699	missense	probably damaging	1.00
R8268:Sh3pxd2a	UTSW	19	47267594	missense	probably benign
R8290:Sh3pxd2a	UTSW	19	47314136	missense	probably damaging	1.00
R8350:Sh3pxd2a	UTSW	19	47268707	missense	probably damaging	1.00
R8350:Sh3pxd2a	UTSW	19	47269838	missense	probably null	0.72
R8742:Sh3pxd2a	UTSW	19	47286634	missense	probably benign	0.01
R8767:Sh3pxd2a	UTSW	19	47268906	missense	probably damaging	1.00
R8948:Sh3pxd2a	UTSW	19	47373443	missense	probably damaging	1.00
R9357:Sh3pxd2a	UTSW	19	47272009	missense	probably damaging	1.00
R9433:Sh3pxd2a	UTSW	19	47267100	missense	probably damaging	0.98
R9515:Sh3pxd2a	UTSW	19	47267171	missense	probably damaging	1.00
R9748:Sh3pxd2a	UTSW	19	47268654	missense	probably benign
V3553:Sh3pxd2a	UTSW	19	47267219	missense	probably benign	0.12
X0013:Sh3pxd2a	UTSW	19	47267864	missense	probably benign	0.01
X0026:Sh3pxd2a	UTSW	19	47464150	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GAACTCTTGGCTGTGCATGG -3'
(R):5'- AGTTAGTACGAGGCTGAGCG -3'

Sequencing Primer
(F):5'- AAGGGGATCACAGACTGCCTC -3'
(R):5'- CACAGCCTCAGATTAACTGT -3'

Posted On

2014-10-01