Incidental Mutation 'R2166:Kcnb2'
ID 235473
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms Kv2.2, 9630047L19Rik
MMRRC Submission 040169-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2166 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 15357478-15793974 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 15781540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 804 (D804A)
Ref Sequence ENSEMBL: ENSMUSP00000135382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect possibly damaging
Transcript: ENSMUST00000170146
AA Change: D804A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000175681
AA Change: D804A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: D804A

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Meta Mutation Damage Score 0.2176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,716,762 (GRCm39) F779I probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Birc6 A T 17: 74,942,790 (GRCm39) T2761S probably benign Het
Cav1 A T 6: 17,339,430 (GRCm39) I141F possibly damaging Het
Cmklr2 A G 1: 63,223,107 (GRCm39) F43L probably benign Het
Gm973 A G 1: 59,565,898 (GRCm39) D39G possibly damaging Het
Gucy1a2 T A 9: 3,579,513 (GRCm39) probably null Het
Il1b A T 2: 129,206,968 (GRCm39) M264K probably damaging Het
Itpr1 A G 6: 108,365,186 (GRCm39) Y38C probably damaging Het
Kcnt1 T A 2: 25,781,195 (GRCm39) probably benign Het
Krt6b T C 15: 101,587,050 (GRCm39) probably null Het
Mef2a A G 7: 66,915,870 (GRCm39) V144A probably damaging Het
Mroh3 A G 1: 136,113,791 (GRCm39) M666T probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Nalcn T A 14: 123,607,363 (GRCm39) Y702F probably benign Het
Napepld T A 5: 21,888,230 (GRCm39) K73I possibly damaging Het
Or5h23 T A 16: 58,905,949 (GRCm39) K299I probably benign Het
Or8g21 G A 9: 38,906,513 (GRCm39) Q73* probably null Het
Pappa A C 4: 65,074,682 (GRCm39) D412A probably damaging Het
Plbd1 A G 6: 136,590,788 (GRCm39) probably null Het
Ppp1r10 G T 17: 36,241,481 (GRCm39) R752L unknown Het
Prep T C 10: 44,968,751 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptprz1 A G 6: 23,045,632 (GRCm39) N2134S possibly damaging Het
Rhbdl3 A G 11: 80,210,523 (GRCm39) Y92C probably damaging Het
Rtkn2 T C 10: 67,877,526 (GRCm39) S532P possibly damaging Het
Rtl1 T A 12: 109,556,988 (GRCm39) H1617L probably damaging Het
Skint6 T A 4: 112,711,649 (GRCm39) N956I probably benign Het
Slc13a2 A G 11: 78,293,901 (GRCm39) V287A probably benign Het
Slc9a2 A G 1: 40,781,928 (GRCm39) K386E probably damaging Het
Spata20 G A 11: 94,369,930 (GRCm39) H789Y probably benign Het
Stk19 A G 17: 35,051,486 (GRCm39) I23T possibly damaging Het
Tonsl A G 15: 76,521,513 (GRCm39) I293T probably benign Het
Topbp1 A G 9: 103,190,128 (GRCm39) probably null Het
Trappc2l T A 8: 123,339,901 (GRCm39) S44T probably benign Het
Tsr1 A G 11: 74,798,280 (GRCm39) probably null Het
Ugdh A G 5: 65,574,357 (GRCm39) probably benign Het
Unc119 A G 11: 78,238,161 (GRCm39) probably null Het
Zkscan14 G A 5: 145,132,944 (GRCm39) P196S probably benign Het
Zmat4 T C 8: 24,392,152 (GRCm39) L36P probably damaging Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15,781,236 (GRCm39) missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15,383,147 (GRCm39) missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15,781,048 (GRCm39) missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15,383,178 (GRCm39) missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15,781,033 (GRCm39) missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15,780,085 (GRCm39) missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15,781,159 (GRCm39) missense probably benign
IGL02526:Kcnb2 APN 1 15,780,979 (GRCm39) missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15,780,730 (GRCm39) missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15,781,435 (GRCm39) missense probably benign
IGL03144:Kcnb2 APN 1 15,780,112 (GRCm39) missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15,383,200 (GRCm39) missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15,783,137 (GRCm39) unclassified probably benign
R0538:Kcnb2 UTSW 1 15,783,108 (GRCm39) unclassified probably benign
R0611:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15,781,012 (GRCm39) missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15,779,979 (GRCm39) missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15,779,990 (GRCm39) missense possibly damaging 0.66
R2444:Kcnb2 UTSW 1 15,779,791 (GRCm39) missense probably benign
R3025:Kcnb2 UTSW 1 15,781,059 (GRCm39) missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15,780,639 (GRCm39) missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15,383,186 (GRCm39) missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15,779,724 (GRCm39) missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15,781,068 (GRCm39) missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15,781,716 (GRCm39) missense probably benign
R5926:Kcnb2 UTSW 1 15,383,235 (GRCm39) missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15,780,790 (GRCm39) missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15,781,436 (GRCm39) missense probably benign
R6724:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15,780,480 (GRCm39) missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15,383,150 (GRCm39) missense probably benign
R7352:Kcnb2 UTSW 1 15,780,835 (GRCm39) missense probably benign
R7419:Kcnb2 UTSW 1 15,781,251 (GRCm39) missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15,780,031 (GRCm39) missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15,383,064 (GRCm39) missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15,780,837 (GRCm39) missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15,383,004 (GRCm39) missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15,781,851 (GRCm39) makesense probably null
R8156:Kcnb2 UTSW 1 15,780,280 (GRCm39) missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15,781,777 (GRCm39) missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15,382,934 (GRCm39) missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15,780,876 (GRCm39) missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15,780,648 (GRCm39) missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15,781,723 (GRCm39) missense probably benign
R9321:Kcnb2 UTSW 1 15,779,793 (GRCm39) missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15,779,737 (GRCm39) missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15,781,444 (GRCm39) missense probably benign
R9709:Kcnb2 UTSW 1 15,780,523 (GRCm39) missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15,781,252 (GRCm39) missense probably benign 0.01
Z1088:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.03
Z1177:Kcnb2 UTSW 1 15,781,182 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTAACCACAGCTGACTTTCCG -3'
(R):5'- CACAGCCTGGTAAATGTCTTGC -3'

Sequencing Primer
(F):5'- ACAGCTGACTTTCCGCTCAC -3'
(R):5'- AGCCTGGTAAATGTCTTGCCTACAG -3'
Posted On 2014-10-01