Mutagenetix > Incidental Mutation

Incidental Mutation 'R2166:Kcnb2'

235473

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

040169-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2166 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 15711316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 804 (D804A)

Ref Sequence

ENSEMBL: ENSMUSP00000135382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170146
AA Change: D804A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000175681
AA Change: D804A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: D804A

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Meta Mutation Damage Score

0.2176

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,568,643	F779I	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Birc6	A	T	17: 74,635,795	T2761S	probably benign	Het
Cav1	A	T	6: 17,339,431	I141F	possibly damaging	Het
Gm973	A	G	1: 59,526,739	D39G	possibly damaging	Het
Gpr1	A	G	1: 63,183,948	F43L	probably benign	Het
Gucy1a2	T	A	9: 3,579,513		probably null	Het
Il1b	A	T	2: 129,365,048	M264K	probably damaging	Het
Itpr1	A	G	6: 108,388,225	Y38C	probably damaging	Het
Kcnt1	T	A	2: 25,891,183		probably benign	Het
Krt6b	T	C	15: 101,678,615		probably null	Het
Mef2a	A	G	7: 67,266,122	V144A	probably damaging	Het
Mroh3	A	G	1: 136,186,053	M666T	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nalcn	T	A	14: 123,369,951	Y702F	probably benign	Het
Napepld	T	A	5: 21,683,232	K73I	possibly damaging	Het
Olfr191	T	A	16: 59,085,586	K299I	probably benign	Het
Olfr935	G	A	9: 38,995,217	Q73*	probably null	Het
Pappa	A	C	4: 65,156,445	D412A	probably damaging	Het
Plbd1	A	G	6: 136,613,790		probably null	Het
Ppp1r10	G	T	17: 35,930,589	R752L	unknown	Het
Prep	T	C	10: 45,092,655		probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptprz1	A	G	6: 23,045,633	N2134S	possibly damaging	Het
Rhbdl3	A	G	11: 80,319,697	Y92C	probably damaging	Het
Rtkn2	T	C	10: 68,041,696	S532P	possibly damaging	Het
Rtl1	T	A	12: 109,590,554	H1617L	probably damaging	Het
Skint6	T	A	4: 112,854,452	N956I	probably benign	Het
Slc13a2	A	G	11: 78,403,075	V287A	probably benign	Het
Slc9a2	A	G	1: 40,742,768	K386E	probably damaging	Het
Spata20	G	A	11: 94,479,104	H789Y	probably benign	Het
Stk19	A	G	17: 34,832,510	I23T	possibly damaging	Het
Tonsl	A	G	15: 76,637,313	I293T	probably benign	Het
Topbp1	A	G	9: 103,312,929		probably null	Het
Trappc2l	T	A	8: 122,613,162	S44T	probably benign	Het
Tsr1	A	G	11: 74,907,454		probably null	Het
Ugdh	A	G	5: 65,417,014		probably benign	Het
Unc119	A	G	11: 78,347,335		probably null	Het
Zkscan14	G	A	5: 145,196,134	P196S	probably benign	Het
Zmat4	T	C	8: 23,902,136	L36P	probably damaging	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R3886:Kcnb2	UTSW	1	15710415	missense	probably damaging	1.00
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5096:Kcnb2	UTSW	1	15710844	missense	probably benign	0.45
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6371:Kcnb2	UTSW	1	15711212	missense	probably benign
R6724:Kcnb2	UTSW	1	15710440	missense	probably damaging	1.00
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7043:Kcnb2	UTSW	1	15312926	missense	probably benign
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8156:Kcnb2	UTSW	1	15710056	missense	probably damaging	1.00
R8408:Kcnb2	UTSW	1	15711553	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGTAACCACAGCTGACTTTCCG -3'
(R):5'- CACAGCCTGGTAAATGTCTTGC -3'

Sequencing Primer
(F):5'- ACAGCTGACTTTCCGCTCAC -3'
(R):5'- AGCCTGGTAAATGTCTTGCCTACAG -3'

Posted On

2014-10-01