Incidental Mutation 'R2166:Mroh3'
ID235477
Institutional Source Beutler Lab
Gene Symbol Mroh3
Ensembl Gene ENSMUSG00000087230
Gene Namemaestro heat-like repeat family member 3
Synonyms
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136181652-136212828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136186053 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 666 (M666T)
Ref Sequence ENSEMBL: ENSMUSP00000148632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168561] [ENSMUST00000212798]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166708
Predicted Effect probably benign
Transcript: ENSMUST00000168561
SMART Domains Protein: ENSMUSP00000130772
Gene: ENSMUSG00000087230

DomainStartEndE-ValueType
SCOP:d1gw5a_ 126 669 2e-7 SMART
low complexity region 677 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168561
Predicted Effect probably benign
Transcript: ENSMUST00000212798
AA Change: M666T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Mroh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Mroh3 UTSW 1 136190803 missense probably benign 0.00
R0507:Mroh3 UTSW 1 136190980 missense probably damaging 1.00
R0638:Mroh3 UTSW 1 136191002 missense probably damaging 1.00
R0742:Mroh3 UTSW 1 136190980 missense probably damaging 1.00
R1728:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1729:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1730:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1739:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1762:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1783:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1784:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1785:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1862:Mroh3 UTSW 1 136185988 missense probably benign 0.01
R1883:Mroh3 UTSW 1 136206993 missense probably damaging 1.00
R2566:Mroh3 UTSW 1 136198126 missense probably damaging 1.00
R3713:Mroh3 UTSW 1 136185976 missense probably benign 0.01
R3788:Mroh3 UTSW 1 136185475 missense probably damaging 1.00
R4672:Mroh3 UTSW 1 136190975 missense probably benign 0.09
R4747:Mroh3 UTSW 1 136185499 missense probably benign 0.00
R4855:Mroh3 UTSW 1 136200939 critical splice donor site probably null
R5171:Mroh3 UTSW 1 136191656 missense possibly damaging 0.82
R5296:Mroh3 UTSW 1 136196323 missense probably damaging 0.98
R5869:Mroh3 UTSW 1 136186123 missense probably benign
R6347:Mroh3 UTSW 1 136200937 splice site probably null
R6531:Mroh3 UTSW 1 136184353 missense probably benign 0.01
R6675:Mroh3 UTSW 1 136190812 missense possibly damaging 0.65
R7015:Mroh3 UTSW 1 136183331 missense probably damaging 1.00
R7587:Mroh3 UTSW 1 136190998 missense probably benign 0.09
R7657:Mroh3 UTSW 1 136181794 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACACTGTTGGGGCTAAAAGG -3'
(R):5'- TCCCGAGTGCAATGTGTGAG -3'

Sequencing Primer
(F):5'- AATAGCTCCACCCTTCTCCATTGG -3'
(R):5'- CAATGTGTGAGAGCTTGTGCC -3'
Posted On2014-10-01