Incidental Mutation 'R2166:Il1b'
ID235480
Institutional Source Beutler Lab
Gene Symbol Il1b
Ensembl Gene ENSMUSG00000027398
Gene Nameinterleukin 1 beta
SynonymsIL-1B, IL-1beta
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129364570-129371139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129365048 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 264 (M264K)
Ref Sequence ENSEMBL: ENSMUSP00000028881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028881]
PDB Structure
THE STRUCTURE OF MURINE INTERLEUKIN-1 BETA AT 2.8 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
A COMPARISON OF THE HIGH RESOLUTION STRUCTURES OF HUMAN AND MURINE INTERLEUKIN-1B [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028881
AA Change: M264K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028881
Gene: ENSMUSG00000027398
AA Change: M264K

DomainStartEndE-ValueType
Pfam:IL1_propep 1 102 3.3e-37 PFAM
IL1 120 265 1.74e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156601
Meta Mutation Damage Score 0.7018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1. The encoded protein plays a role in thymocyte proliferation and is involved in the inflammatory response. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants show impaired contact hypersensitivity and reduced acute-phase inflammatory response. Lung tumors and metastases of B16 melanoma do not occur in null mutant mice, suggesting inability to support tumor invasiveness and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Il1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Il1b APN 2 129367333 missense possibly damaging 0.82
IGL01488:Il1b APN 2 129367234 splice site probably benign
IGL01810:Il1b APN 2 129369729 missense probably damaging 1.00
IGL02041:Il1b APN 2 129369742 missense possibly damaging 0.95
IGL02726:Il1b APN 2 129367322 missense probably damaging 1.00
IGL02793:Il1b APN 2 129367251 missense probably benign 0.00
IGL02875:Il1b APN 2 129367251 missense probably benign 0.00
IGL02884:Il1b APN 2 129365102 missense probably benign 0.02
R1065:Il1b UTSW 2 129368007 missense probably benign 0.00
R1656:Il1b UTSW 2 129366069 missense probably damaging 0.99
R1761:Il1b UTSW 2 129365181 missense probably damaging 1.00
R2568:Il1b UTSW 2 129367322 missense probably damaging 1.00
R4807:Il1b UTSW 2 129370306 missense probably benign 0.00
R7684:Il1b UTSW 2 129367357 missense probably benign 0.03
Z1177:Il1b UTSW 2 129369745 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGTGGTTGCCCATCAGAGG -3'
(R):5'- TGTGGATCCCAAGCAATACCC -3'

Sequencing Primer
(F):5'- CAGGCTCTCTTTGAACAGAATGTGC -3'
(R):5'- CAAGCAATACCCAAAGAAGAAGATG -3'
Posted On2014-10-01