Incidental Mutation 'R2166:Napepld'
ID235484
Institutional Source Beutler Lab
Gene Symbol Napepld
Ensembl Gene ENSMUSG00000044968
Gene NameN-acyl phosphatidylethanolamine phospholipase D
SynonymsNAPE-PLD
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21662901-21701396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21683232 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 73 (K73I)
Ref Sequence ENSEMBL: ENSMUSP00000110872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060899] [ENSMUST00000115217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060899
AA Change: K73I

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054458
Gene: ENSMUSG00000044968
AA Change: K73I

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.5e-14 PFAM
Pfam:Lactamase_B_2 142 344 2.7e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115217
AA Change: K73I

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110872
Gene: ENSMUSG00000044968
AA Change: K73I

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.3e-13 PFAM
Pfam:Lactamase_B_2 142 344 1.4e-39 PFAM
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NAPEPLD is a phospholipase D type enzyme that catalyzes the release of N-acylethanolamine (NAE) from N-acyl-phosphatidylethanolamine (NAPE) in the second step of the biosynthesis of N-acylethanolamine (Okamoto et al., 2004 [PubMed 14634025]).[supplied by OMIM, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and healthy, but have abnormal brain levels of N-acyl ethanolamines and N-acyl phosphatidylethanolamines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Napepld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Napepld APN 5 21683193 missense probably benign 0.11
IGL01659:Napepld APN 5 21675716 missense probably damaging 0.99
IGL01726:Napepld APN 5 21675659 missense possibly damaging 0.93
IGL02083:Napepld APN 5 21676067 missense probably damaging 1.00
IGL02425:Napepld APN 5 21683442 missense probably benign 0.19
R1763:Napepld UTSW 5 21683410 missense probably benign 0.00
R1903:Napepld UTSW 5 21665272 missense probably damaging 0.97
R3861:Napepld UTSW 5 21683289 missense probably benign 0.32
R4899:Napepld UTSW 5 21683440 missense probably benign 0.00
R5629:Napepld UTSW 5 21675903 missense probably benign 0.01
R5794:Napepld UTSW 5 21683431 missense possibly damaging 0.93
R6273:Napepld UTSW 5 21665322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACTAAGTAGAGGCCCATACC -3'
(R):5'- TTCAAAGCTTCTCGCCGAGG -3'

Sequencing Primer
(F):5'- TACCTCCCAGACAAACTAAGTCATG -3'
(R):5'- TATGAGGACAGCCAGTCTCCAG -3'
Posted On2014-10-01