Incidental Mutation 'R2166:Rhbdl3'
ID235503
Institutional Source Beutler Lab
Gene Symbol Rhbdl3
Ensembl Gene ENSMUSG00000017692
Gene Namerhomboid like 3
SynonymsVrho, Ventrhoid, Rhbdl4
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80300912-80355955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80319697 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 92 (Y92C)
Ref Sequence ENSEMBL: ENSMUSP00000017836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017836]
Predicted Effect probably damaging
Transcript: ENSMUST00000017836
AA Change: Y92C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017836
Gene: ENSMUSG00000017692
AA Change: Y92C

DomainStartEndE-ValueType
SCOP:d1c7va_ 36 104 2e-12 SMART
Blast:EFh 38 66 6e-11 BLAST
PDB:2RRT|A 43 102 6e-6 PDB
Blast:EFh 74 102 9e-10 BLAST
transmembrane domain 162 184 N/A INTRINSIC
Pfam:Rhomboid 205 362 1.6e-34 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138846
Meta Mutation Damage Score 0.9439 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Rhbdl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Rhbdl3 APN 11 80353442 missense probably damaging 1.00
IGL02003:Rhbdl3 APN 11 80337516 missense possibly damaging 0.82
IGL02302:Rhbdl3 APN 11 80353681 makesense probably null
IGL02972:Rhbdl3 APN 11 80331916 splice site probably benign
IGL03028:Rhbdl3 APN 11 80323461 nonsense probably null
IGL03033:Rhbdl3 APN 11 80346827 missense probably damaging 0.99
IGL03113:Rhbdl3 APN 11 80353613 missense possibly damaging 0.69
R0193:Rhbdl3 UTSW 11 80353574 missense possibly damaging 0.55
R0358:Rhbdl3 UTSW 11 80353631 missense probably damaging 0.99
R0481:Rhbdl3 UTSW 11 80323349 splice site probably benign
R0616:Rhbdl3 UTSW 11 80331861 missense probably damaging 0.99
R1171:Rhbdl3 UTSW 11 80353592 missense possibly damaging 0.52
R3500:Rhbdl3 UTSW 11 80319705 missense probably damaging 0.98
R4580:Rhbdl3 UTSW 11 80353645 missense probably damaging 1.00
R4900:Rhbdl3 UTSW 11 80319613 missense probably benign 0.13
R5276:Rhbdl3 UTSW 11 80319666 missense probably benign 0.07
R5513:Rhbdl3 UTSW 11 80331842 missense probably damaging 0.99
R5595:Rhbdl3 UTSW 11 80337583 missense probably damaging 0.99
R5941:Rhbdl3 UTSW 11 80331889 missense probably benign 0.18
R6372:Rhbdl3 UTSW 11 80330656 missense probably damaging 1.00
R6935:Rhbdl3 UTSW 11 80337496 missense probably damaging 1.00
R7252:Rhbdl3 UTSW 11 80337585 missense possibly damaging 0.60
R7389:Rhbdl3 UTSW 11 80346839 missense possibly damaging 0.95
R7404:Rhbdl3 UTSW 11 80346833 missense probably damaging 1.00
R7745:Rhbdl3 UTSW 11 80323579 missense possibly damaging 0.74
R7768:Rhbdl3 UTSW 11 80330621 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTAGAGGGCCAGTTCCAC -3'
(R):5'- TCACCTGTTGAAGCTGAGGC -3'

Sequencing Primer
(F):5'- ATCTCTGTGAGTTCAAGGCCAGC -3'
(R):5'- TGTTGAAGCTGAGGCCATTCAAAC -3'
Posted On2014-10-01