Incidental Mutation 'R2166:Krt6b'
ID235510
Institutional Source Beutler Lab
Gene Symbol Krt6b
Ensembl Gene ENSMUSG00000023041
Gene Namekeratin 6B
SynonymsKrt2-6b, mK6[b]
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101676023-101680287 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 101678615 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023786]
Predicted Effect probably null
Transcript: ENSMUST00000023786
SMART Domains Protein: ENSMUSP00000023786
Gene: ENSMUSG00000023041

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 1.3e-36 PFAM
Filament 151 464 2.79e-175 SMART
low complexity region 483 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198940
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Krt6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Krt6b APN 15 101679832 missense probably benign 0.22
IGL01653:Krt6b APN 15 101679114 missense probably damaging 1.00
IGL01900:Krt6b APN 15 101677546 missense possibly damaging 0.45
IGL03187:Krt6b APN 15 101679957 missense probably benign
R0511:Krt6b UTSW 15 101677607 splice site probably benign
R0788:Krt6b UTSW 15 101677519 missense probably damaging 0.96
R1370:Krt6b UTSW 15 101677552 missense probably damaging 0.96
R1481:Krt6b UTSW 15 101678374 missense probably benign 0.05
R2007:Krt6b UTSW 15 101678127 missense probably damaging 1.00
R2112:Krt6b UTSW 15 101678564 missense possibly damaging 0.48
R2227:Krt6b UTSW 15 101679122 missense probably damaging 0.96
R2495:Krt6b UTSW 15 101678322 missense probably damaging 1.00
R2496:Krt6b UTSW 15 101679781 missense probably damaging 1.00
R4726:Krt6b UTSW 15 101678085 missense probably damaging 0.98
R4969:Krt6b UTSW 15 101680025 missense possibly damaging 0.71
R6301:Krt6b UTSW 15 101678951 missense probably damaging 1.00
R6646:Krt6b UTSW 15 101677214 missense probably damaging 0.98
R7232:Krt6b UTSW 15 101678142 missense probably damaging 1.00
R7406:Krt6b UTSW 15 101679078 missense probably benign 0.04
R7414:Krt6b UTSW 15 101679014 missense probably benign 0.05
R7849:Krt6b UTSW 15 101678574 missense probably damaging 1.00
R7932:Krt6b UTSW 15 101678574 missense probably damaging 1.00
Z1177:Krt6b UTSW 15 101678332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCATCTACATCCTGAG -3'
(R):5'- GGAGGGTCCAGGTTTATAGGAC -3'

Sequencing Primer
(F):5'- GAGTCAGGTTAACTCTCCAGC -3'
(R):5'- TCCAGGTTTATAGGACATTAAGGG -3'
Posted On2014-10-01