Incidental Mutation 'R2166:Mslnl'
ID 235512
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 040169-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2166 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25961908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,716,762 (GRCm39) F779I probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Birc6 A T 17: 74,942,790 (GRCm39) T2761S probably benign Het
Cav1 A T 6: 17,339,430 (GRCm39) I141F possibly damaging Het
Cmklr2 A G 1: 63,223,107 (GRCm39) F43L probably benign Het
Gm973 A G 1: 59,565,898 (GRCm39) D39G possibly damaging Het
Gucy1a2 T A 9: 3,579,513 (GRCm39) probably null Het
Il1b A T 2: 129,206,968 (GRCm39) M264K probably damaging Het
Itpr1 A G 6: 108,365,186 (GRCm39) Y38C probably damaging Het
Kcnb2 A C 1: 15,781,540 (GRCm39) D804A possibly damaging Het
Kcnt1 T A 2: 25,781,195 (GRCm39) probably benign Het
Krt6b T C 15: 101,587,050 (GRCm39) probably null Het
Mef2a A G 7: 66,915,870 (GRCm39) V144A probably damaging Het
Mroh3 A G 1: 136,113,791 (GRCm39) M666T probably benign Het
Nalcn T A 14: 123,607,363 (GRCm39) Y702F probably benign Het
Napepld T A 5: 21,888,230 (GRCm39) K73I possibly damaging Het
Or5h23 T A 16: 58,905,949 (GRCm39) K299I probably benign Het
Or8g21 G A 9: 38,906,513 (GRCm39) Q73* probably null Het
Pappa A C 4: 65,074,682 (GRCm39) D412A probably damaging Het
Plbd1 A G 6: 136,590,788 (GRCm39) probably null Het
Ppp1r10 G T 17: 36,241,481 (GRCm39) R752L unknown Het
Prep T C 10: 44,968,751 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptprz1 A G 6: 23,045,632 (GRCm39) N2134S possibly damaging Het
Rhbdl3 A G 11: 80,210,523 (GRCm39) Y92C probably damaging Het
Rtkn2 T C 10: 67,877,526 (GRCm39) S532P possibly damaging Het
Rtl1 T A 12: 109,556,988 (GRCm39) H1617L probably damaging Het
Skint6 T A 4: 112,711,649 (GRCm39) N956I probably benign Het
Slc13a2 A G 11: 78,293,901 (GRCm39) V287A probably benign Het
Slc9a2 A G 1: 40,781,928 (GRCm39) K386E probably damaging Het
Spata20 G A 11: 94,369,930 (GRCm39) H789Y probably benign Het
Stk19 A G 17: 35,051,486 (GRCm39) I23T possibly damaging Het
Tonsl A G 15: 76,521,513 (GRCm39) I293T probably benign Het
Topbp1 A G 9: 103,190,128 (GRCm39) probably null Het
Trappc2l T A 8: 123,339,901 (GRCm39) S44T probably benign Het
Tsr1 A G 11: 74,798,280 (GRCm39) probably null Het
Ugdh A G 5: 65,574,357 (GRCm39) probably benign Het
Unc119 A G 11: 78,238,161 (GRCm39) probably null Het
Zkscan14 G A 5: 145,132,944 (GRCm39) P196S probably benign Het
Zmat4 T C 8: 24,392,152 (GRCm39) L36P probably damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCCATCAGAAGGGAGGTTTG -3'
(R):5'- ACAGGTCTGAAGCACTGAGC -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- GCCCTGCCGAGACAGTAG -3'
Posted On 2014-10-01