Incidental Mutation 'R2166:Ppp1r10'
ID235514
Institutional Source Beutler Lab
Gene Symbol Ppp1r10
Ensembl Gene ENSMUSG00000039220
Gene Nameprotein phosphatase 1, regulatory subunit 10
SynonymsPNUTS, D17Ertd808e, 2610025H06Rik
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35916434-35932283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35930589 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 752 (R752L)
Ref Sequence ENSEMBL: ENSMUSP00000084461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087210] [ENSMUST00000087211]
Predicted Effect unknown
Transcript: ENSMUST00000087210
AA Change: R752L
SMART Domains Protein: ENSMUSP00000084460
Gene: ENSMUSG00000039220
AA Change: R752L

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087211
AA Change: R752L
SMART Domains Protein: ENSMUSP00000084461
Gene: ENSMUSG00000039220
AA Change: R752L

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151375
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase 1 binding protein. The encoded protein plays a role in many cellular processes including cell cycle progression, DNA repair and apoptosis by regulating the activity of protein phosphatase 1. This gene lies within the major histocompatibility complex class I region on chromosome 6, and alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Ppp1r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp1r10 APN 17 35924859 missense probably damaging 0.99
IGL01113:Ppp1r10 APN 17 35929559 missense probably damaging 0.98
IGL01144:Ppp1r10 APN 17 35926564 missense probably benign 0.28
IGL01650:Ppp1r10 APN 17 35931161 missense unknown
IGL02445:Ppp1r10 APN 17 35926202 missense probably damaging 1.00
IGL02715:Ppp1r10 APN 17 35930712 missense unknown
IGL02797:Ppp1r10 APN 17 35928012 critical splice donor site probably null
IGL03181:Ppp1r10 APN 17 35930624 nonsense probably null
R1183:Ppp1r10 UTSW 17 35929443 missense possibly damaging 0.56
R1710:Ppp1r10 UTSW 17 35926536 missense probably damaging 0.96
R2865:Ppp1r10 UTSW 17 35928492 missense possibly damaging 0.86
R2898:Ppp1r10 UTSW 17 35928892 missense probably damaging 1.00
R3692:Ppp1r10 UTSW 17 35930868 missense unknown
R4612:Ppp1r10 UTSW 17 35927931 missense probably damaging 1.00
R4716:Ppp1r10 UTSW 17 35929460 missense probably benign 0.16
R4796:Ppp1r10 UTSW 17 35924087 missense probably damaging 1.00
R4997:Ppp1r10 UTSW 17 35924084 missense probably damaging 1.00
R5152:Ppp1r10 UTSW 17 35929252 missense probably damaging 1.00
R5186:Ppp1r10 UTSW 17 35928511 missense probably damaging 1.00
R5364:Ppp1r10 UTSW 17 35930432 missense unknown
R5705:Ppp1r10 UTSW 17 35929489 missense probably damaging 1.00
R5847:Ppp1r10 UTSW 17 35926847 missense possibly damaging 0.85
R6912:Ppp1r10 UTSW 17 35929561 missense possibly damaging 0.70
R6974:Ppp1r10 UTSW 17 35929551 missense probably benign 0.03
R7169:Ppp1r10 UTSW 17 35929473 missense probably damaging 1.00
R7302:Ppp1r10 UTSW 17 35930881 missense unknown
R7403:Ppp1r10 UTSW 17 35929434 missense probably benign 0.05
R7427:Ppp1r10 UTSW 17 35930133 missense possibly damaging 0.53
Z1088:Ppp1r10 UTSW 17 35930767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGATCCAATGCGAGGTG -3'
(R):5'- TGGCTAGGGACATCATGTGG -3'

Sequencing Primer
(F):5'- CAATGCGAGGTGGCCCAATG -3'
(R):5'- ACATCATGTGGTCGGTGTCC -3'
Posted On2014-10-01