Incidental Mutation 'R2167:Disp2'
List |< first << previous [record 15 of 56] next >> last >|
ID235523
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Namedispatched RND tramsporter family member 2
SynonymsB230210L08Rik, DispB
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118779719-118811293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 118791685 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 966 (E966A)
Ref Sequence ENSEMBL: ENSMUSP00000037136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]
Predicted Effect probably damaging
Transcript: ENSMUST00000037547
AA Change: E966A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: E966A

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Pfam:MMPL 435 635 9.7e-8 PFAM
Pfam:Sterol-sensing 458 611 9.1e-9 PFAM
transmembrane domain 657 679 N/A INTRINSIC
low complexity region 682 695 N/A INTRINSIC
low complexity region 748 761 N/A INTRINSIC
transmembrane domain 914 936 N/A INTRINSIC
transmembrane domain 943 965 N/A INTRINSIC
transmembrane domain 975 997 N/A INTRINSIC
transmembrane domain 1018 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110843
SMART Domains Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142072
Meta Mutation Damage Score 0.1043 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118786278 missense probably damaging 1.00
IGL00970:Disp2 APN 2 118791793 missense probably damaging 1.00
IGL01790:Disp2 APN 2 118790880 missense probably damaging 1.00
IGL01809:Disp2 APN 2 118787264 splice site probably benign
IGL02069:Disp2 APN 2 118790680 missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118790869 missense probably benign
IGL02143:Disp2 APN 2 118789969 missense probably damaging 1.00
IGL02155:Disp2 APN 2 118791804 missense probably damaging 1.00
IGL02884:Disp2 APN 2 118787551 splice site probably benign
IGL03113:Disp2 APN 2 118790778 splice site probably null
IGL03194:Disp2 APN 2 118787629 missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118787644 missense probably benign 0.01
R0109:Disp2 UTSW 2 118791816 missense probably damaging 1.00
R0126:Disp2 UTSW 2 118790338 missense probably damaging 1.00
R0603:Disp2 UTSW 2 118792006 missense probably damaging 1.00
R0610:Disp2 UTSW 2 118792236 missense probably benign 0.02
R0639:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0673:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118789762 missense probably benign 0.00
R0781:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1110:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1243:Disp2 UTSW 2 118791822 missense probably damaging 1.00
R1587:Disp2 UTSW 2 118791583 missense probably damaging 1.00
R1739:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R1771:Disp2 UTSW 2 118791297 nonsense probably null
R1781:Disp2 UTSW 2 118792561 missense probably damaging 0.96
R1918:Disp2 UTSW 2 118791927 missense probably benign
R1956:Disp2 UTSW 2 118792223 missense probably benign 0.02
R2206:Disp2 UTSW 2 118792244 missense probably benign 0.02
R4031:Disp2 UTSW 2 118791880 missense probably benign 0.27
R4617:Disp2 UTSW 2 118790162 missense probably benign
R4656:Disp2 UTSW 2 118790563 missense probably damaging 1.00
R4684:Disp2 UTSW 2 118792756 missense probably damaging 1.00
R4696:Disp2 UTSW 2 118791684 nonsense probably null
R4697:Disp2 UTSW 2 118791684 nonsense probably null
R4738:Disp2 UTSW 2 118790326 missense probably damaging 0.97
R4834:Disp2 UTSW 2 118792504 missense probably benign 0.09
R4914:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4915:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4918:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R5045:Disp2 UTSW 2 118792062 missense probably benign 0.03
R5208:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R5303:Disp2 UTSW 2 118810848 unclassified probably benign
R5350:Disp2 UTSW 2 118787575 missense probably benign 0.23
R5355:Disp2 UTSW 2 118786911 missense probably benign 0.00
R6011:Disp2 UTSW 2 118790820 missense possibly damaging 0.65
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6139:Disp2 UTSW 2 118790662 missense probably damaging 0.97
R6169:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R6187:Disp2 UTSW 2 118792143 missense probably damaging 1.00
R6209:Disp2 UTSW 2 118786921 missense probably damaging 1.00
R6250:Disp2 UTSW 2 118790766 missense probably damaging 1.00
R6392:Disp2 UTSW 2 118790749 missense probably damaging 1.00
R7138:Disp2 UTSW 2 118786880 missense probably benign
R7156:Disp2 UTSW 2 118791811 missense probably damaging 1.00
R7230:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R7400:Disp2 UTSW 2 118791886 missense probably damaging 1.00
R7460:Disp2 UTSW 2 118789780 missense probably damaging 1.00
R7505:Disp2 UTSW 2 118791088 missense probably damaging 1.00
R7542:Disp2 UTSW 2 118791118 missense probably damaging 0.97
R7728:Disp2 UTSW 2 118791480 missense probably benign 0.31
R7757:Disp2 UTSW 2 118790910 missense probably damaging 1.00
R7798:Disp2 UTSW 2 118791879 missense probably benign
R7945:Disp2 UTSW 2 118792789 missense probably damaging 1.00
R8013:Disp2 UTSW 2 118789682 nonsense probably null
R8085:Disp2 UTSW 2 118786971 missense possibly damaging 0.94
R8179:Disp2 UTSW 2 118792549 missense probably damaging 0.99
R8288:Disp2 UTSW 2 118790281 missense probably damaging 1.00
R8345:Disp2 UTSW 2 118810803 missense unknown
R8385:Disp2 UTSW 2 118790410 missense probably damaging 1.00
Z1177:Disp2 UTSW 2 118789702 missense probably damaging 0.99
Z1177:Disp2 UTSW 2 118790827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCAACTTGGAGCTGTAC -3'
(R):5'- TGGAAGGCAGCATGATCACAC -3'

Sequencing Primer
(F):5'- ACTAGCCTTTGCCACACT -3'
(R):5'- GGCAGCATGATCACACCAGAG -3'
Posted On2014-10-01