Mutagenetix > Incidental Mutation

Incidental Mutation 'R2167:Tbx15'

235527

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

040170-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R2167 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 99326455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

probably benign
Transcript: ENSMUST00000029462

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	C	T	11: 9,288,532	T710M	probably benign	Het
Acan	A	G	7: 79,099,957	E1492G	probably benign	Het
Acsl1	A	G	8: 46,533,590	D638G	possibly damaging	Het
Acsl6	C	A	11: 54,327,157	T207K	probably benign	Het
Ahnak	A	T	19: 9,011,494	K3381*	probably null	Het
Art1	T	C	7: 102,106,824	V74A	probably damaging	Het
Bhmt2	A	T	13: 93,662,504	W270R	probably benign	Het
Calm2	T	C	17: 87,435,145	T118A	probably benign	Het
Ccdc88b	G	T	19: 6,854,084	Q497K	possibly damaging	Het
Ccne2	A	T	4: 11,197,249	M183L	probably benign	Het
Cdc42bpg	A	G	19: 6,317,677	I1026V	probably damaging	Het
Celsr2	T	C	3: 108,413,193	T768A	probably damaging	Het
Cog5	T	C	12: 31,837,289	F470L	probably damaging	Het
Cpne5	T	C	17: 29,162,332	D374G	probably damaging	Het
Disp2	A	C	2: 118,791,685	E966A	probably damaging	Het
Dmrtc2	C	T	7: 24,873,919		probably benign	Het
Eif2b3	T	A	4: 117,028,540	I93N	probably damaging	Het
Elfn2	C	A	15: 78,672,446	V634L	probably benign	Het
Fasl	T	G	1: 161,787,138	S119R	probably benign	Het
Foxp2	C	G	6: 15,437,902	P701A	probably damaging	Het
Helz	T	A	11: 107,672,964		probably benign	Het
Kctd6	T	C	14: 8,222,683	V175A	probably benign	Het
Leo1	A	G	9: 75,445,709	N178S	probably benign	Het
Lhx6	C	A	2: 36,103,359	R80L	probably damaging	Het
Man1a2	A	G	3: 100,591,900	L406P	probably damaging	Het
Mapkap1	T	C	2: 34,597,482	F231L	probably damaging	Het
Mknk2	A	G	10: 80,668,701	Y256H	probably damaging	Het
Msh6	A	G	17: 87,989,483	T1203A	probably damaging	Het
Nbeal2	T	C	9: 110,638,308	Y604C	probably damaging	Het
Ncam1	G	T	9: 49,568,481	Q66K	probably benign	Het
Nsd2	T	A	5: 33,882,919	H933Q	probably damaging	Het
Olfr1341	T	C	4: 118,710,055	V216A	probably benign	Het
Olfr1564	T	A	17: 33,215,568	I262F	probably damaging	Het
Olfr191	T	A	16: 59,085,586	K299I	probably benign	Het
Olfr709-ps1	A	G	7: 106,926,590	Y290H	probably damaging	Het
Pappa	A	C	4: 65,156,445	D412A	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rassf6	C	T	5: 90,603,938	E308K	probably damaging	Het
Rb1	T	C	14: 73,211,651	T680A	probably damaging	Het
Rfpl4	T	A	7: 5,110,853	I104F	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnase6	A	C	14: 51,130,517	D122A	probably benign	Het
Rsf1	GGCG	GGCGACGGCAGCG	7: 97,579,906		probably benign	Het
Sec31b	G	A	19: 44,543,353	T39I	possibly damaging	Het
Slc12a1	A	G	2: 125,173,681	I385V	probably damaging	Het
Slc6a17	A	T	3: 107,491,501	Y261*	probably null	Het
Supt6	G	A	11: 78,208,167	P1626L	possibly damaging	Het
Telo2	A	G	17: 25,110,818	V240A	probably benign	Het
Trhr	C	T	15: 44,229,242	L292F	probably damaging	Het
Trps1	G	A	15: 50,831,730	L340F	possibly damaging	Het
Ube2e1	T	C	14: 18,284,429		probably benign	Het
Yeats2	T	C	16: 20,213,401		probably benign	Het
Zbtb39	G	A	10: 127,742,975	E473K	probably benign	Het
Zfp235	T	A	7: 24,140,962	S269T	possibly damaging	Het
Zfp580	C	A	7: 5,053,064	P141Q	possibly damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGCCTGAGCATTATGTCAAG -3'
(R):5'- AGCCTTTTCTGGGATGGGAC -3'

Sequencing Primer
(F):5'- TTAAATCTCTAGCTAAAAGGAAACGG -3'
(R):5'- CTTGGGGATTCTTGAATAAGCCATCC -3'

Posted On

2014-10-01