Incidental Mutation 'R2167:Man1a2'
List |< first << previous [record 25 of 56] next >> last >|
ID235528
Institutional Source Beutler Lab
Gene Symbol Man1a2
Ensembl Gene ENSMUSG00000008763
Gene Namemannosidase, alpha, class 1A, member 2
SynonymsMan1b
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100562208-100685503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100591900 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 406 (L406P)
Ref Sequence ENSEMBL: ENSMUSP00000008907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008907]
Predicted Effect probably damaging
Transcript: ENSMUST00000008907
AA Change: L406P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008907
Gene: ENSMUSG00000008763
AA Change: L406P

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
coiled coil region 101 153 N/A INTRINSIC
low complexity region 155 170 N/A INTRINSIC
Pfam:Glyco_hydro_47 187 626 2.8e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197836
Meta Mutation Damage Score 0.8678 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-mannosidases function at different stages of N-glycan maturation in mammalian cells. See MAN2A1 (MIM 154582) for general information.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress and death within a few hours after birth. Lung development is delayed, the alveolar septum is thickened, and hemorrhage occurs in the alveolar region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Man1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Man1a2 APN 3 100644557 missense probably damaging 1.00
IGL02009:Man1a2 APN 3 100684662 missense probably damaging 0.99
IGL02097:Man1a2 APN 3 100582131 missense possibly damaging 0.68
IGL02395:Man1a2 APN 3 100644537 splice site probably null
IGL02441:Man1a2 APN 3 100591873 missense probably benign 0.01
R0043:Man1a2 UTSW 3 100587880 missense probably damaging 1.00
R0064:Man1a2 UTSW 3 100591883 missense possibly damaging 0.95
R0217:Man1a2 UTSW 3 100617037 missense possibly damaging 0.61
R0266:Man1a2 UTSW 3 100582034 missense probably damaging 1.00
R0284:Man1a2 UTSW 3 100684786 missense probably damaging 0.98
R0633:Man1a2 UTSW 3 100684575 missense possibly damaging 0.80
R1074:Man1a2 UTSW 3 100656086 missense possibly damaging 0.68
R2177:Man1a2 UTSW 3 100632531 missense probably damaging 1.00
R3822:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R4361:Man1a2 UTSW 3 100656042 missense probably benign
R4652:Man1a2 UTSW 3 100632561 missense probably damaging 1.00
R4871:Man1a2 UTSW 3 100617056 missense probably damaging 1.00
R5153:Man1a2 UTSW 3 100656263 missense probably damaging 1.00
R5182:Man1a2 UTSW 3 100647017 missense probably damaging 0.99
R5201:Man1a2 UTSW 3 100617012 missense probably benign
R5251:Man1a2 UTSW 3 100620099 missense probably damaging 1.00
R6135:Man1a2 UTSW 3 100684932 start gained probably benign
R6793:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R6886:Man1a2 UTSW 3 100656071 missense probably benign 0.00
R7209:Man1a2 UTSW 3 100647079 missense unknown
R7224:Man1a2 UTSW 3 100582053 missense possibly damaging 0.85
R7308:Man1a2 UTSW 3 100620105 missense probably damaging 1.00
R7815:Man1a2 UTSW 3 100656179 missense probably damaging 0.99
R7826:Man1a2 UTSW 3 100582139 missense probably damaging 1.00
R8427:Man1a2 UTSW 3 100684685 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ATAGTACATGTACTTCCTAGATGCC -3'
(R):5'- TGTACTCCTACTTGACTAAGTTTGG -3'

Sequencing Primer
(F):5'- CTTCCTAGATGCCTATAATAAAACGG -3'
(R):5'- GGCATGCCACTATGATTAACTG -3'
Posted On2014-10-01