Incidental Mutation 'R2167:Slc6a17'
ID 235529
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 040170-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R2167 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 107398817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 261 (Y261*)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000166892] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect probably null
Transcript: ENSMUST00000029499
AA Change: Y261*
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: Y261*

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166892
SMART Domains Protein: ENSMUSP00000129588
Gene: ENSMUSG00000027894

DomainStartEndE-ValueType
Pfam:SNF 60 116 1.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167975
Predicted Effect probably null
Transcript: ENSMUST00000168211
AA Change: Y220*
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: Y220*

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169413
Predicted Effect probably null
Transcript: ENSMUST00000169449
AA Change: Y261*
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: Y261*

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170429
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,238,532 (GRCm39) T710M probably benign Het
Acan A G 7: 78,749,705 (GRCm39) E1492G probably benign Het
Acsl1 A G 8: 46,986,627 (GRCm39) D638G possibly damaging Het
Acsl6 C A 11: 54,217,983 (GRCm39) T207K probably benign Het
Ahnak A T 19: 8,988,858 (GRCm39) K3381* probably null Het
Art1 T C 7: 101,756,031 (GRCm39) V74A probably damaging Het
Bhmt2 A T 13: 93,799,012 (GRCm39) W270R probably benign Het
Calm2 T C 17: 87,742,573 (GRCm39) T118A probably benign Het
Ccdc88b G T 19: 6,831,452 (GRCm39) Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 (GRCm39) M183L probably benign Het
Cdc42bpg A G 19: 6,367,707 (GRCm39) I1026V probably damaging Het
Celsr2 T C 3: 108,320,509 (GRCm39) T768A probably damaging Het
Cog5 T C 12: 31,887,288 (GRCm39) F470L probably damaging Het
Cpne5 T C 17: 29,381,306 (GRCm39) D374G probably damaging Het
Disp2 A C 2: 118,622,166 (GRCm39) E966A probably damaging Het
Dmrtc2 C T 7: 24,573,344 (GRCm39) probably benign Het
Eif2b3 T A 4: 116,885,737 (GRCm39) I93N probably damaging Het
Elfn2 C A 15: 78,556,646 (GRCm39) V634L probably benign Het
Fasl T G 1: 161,614,707 (GRCm39) S119R probably benign Het
Foxp2 C G 6: 15,437,901 (GRCm39) P701A probably damaging Het
Helz T A 11: 107,563,790 (GRCm39) probably benign Het
Kctd6 T C 14: 8,222,683 (GRCm38) V175A probably benign Het
Leo1 A G 9: 75,352,991 (GRCm39) N178S probably benign Het
Lhx6 C A 2: 35,993,371 (GRCm39) R80L probably damaging Het
Man1a2 A G 3: 100,499,216 (GRCm39) L406P probably damaging Het
Mapkap1 T C 2: 34,487,494 (GRCm39) F231L probably damaging Het
Mknk2 A G 10: 80,504,535 (GRCm39) Y256H probably damaging Het
Msh6 A G 17: 88,296,911 (GRCm39) T1203A probably damaging Het
Nbeal2 T C 9: 110,467,376 (GRCm39) Y604C probably damaging Het
Ncam1 G T 9: 49,479,781 (GRCm39) Q66K probably benign Het
Nsd2 T A 5: 34,040,263 (GRCm39) H933Q probably damaging Het
Or10h5 T A 17: 33,434,542 (GRCm39) I262F probably damaging Het
Or13p3 T C 4: 118,567,252 (GRCm39) V216A probably benign Het
Or2d3c A G 7: 106,525,797 (GRCm39) Y290H probably damaging Het
Or5h23 T A 16: 58,905,949 (GRCm39) K299I probably benign Het
Pappa A C 4: 65,074,682 (GRCm39) D412A probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rassf6 C T 5: 90,751,797 (GRCm39) E308K probably damaging Het
Rb1 T C 14: 73,449,091 (GRCm39) T680A probably damaging Het
Rfpl4 T A 7: 5,113,852 (GRCm39) I104F probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rnase6 A C 14: 51,367,974 (GRCm39) D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,229,113 (GRCm39) probably benign Het
Sec31b G A 19: 44,531,792 (GRCm39) T39I possibly damaging Het
Slc12a1 A G 2: 125,015,601 (GRCm39) I385V probably damaging Het
Supt6 G A 11: 78,098,993 (GRCm39) P1626L possibly damaging Het
Tbx15 A G 3: 99,233,771 (GRCm39) probably benign Het
Telo2 A G 17: 25,329,792 (GRCm39) V240A probably benign Het
Trhr C T 15: 44,092,638 (GRCm39) L292F probably damaging Het
Trps1 G A 15: 50,695,126 (GRCm39) L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 (GRCm38) probably benign Het
Yeats2 T C 16: 20,032,151 (GRCm39) probably benign Het
Zbtb39 G A 10: 127,578,844 (GRCm39) E473K probably benign Het
Zfp235 T A 7: 23,840,387 (GRCm39) S269T possibly damaging Het
Zfp580 C A 7: 5,056,063 (GRCm39) P141Q possibly damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATGTGAAACTGCATGAAGC -3'
(R):5'- CTTGAAAGGCAGAACAGCTCC -3'

Sequencing Primer
(F):5'- ACTGCATGAAGCTGATCTGATG -3'
(R):5'- AGCCGTGCTGACTCCAG -3'
Posted On 2014-10-01